THE JOINT ACADEMIC PROGRAM OF EXECUTIVE MASTER IN SCIENCES AND MANAGEMENT OF THE ENVIRONMENT BETWEEN INDUSTRIAL UNIVERSITY OF HO CHI MINH CITY AND LIÈGE UNIVERSITY NGUYEN DUY RESEARCH MICROORGANISMS IN WET ANAEROBIC FERMENTATION PILOT TO TREAT DOMESTIC WASTE Major: EXECUTIVE MASTER IN SCIENCES AND MANAGEMENT OF THE ENVIRONMENT MASTER’S THESIS HO CHI MINH CITY, YEAR 2018 The project was completed at The Industrial University of Ho Chi Minh City Supervisor’s name: (Write full name and signature) The thesis was taken at The Industrial University of Ho Chi Minh City date … month …… year Committee members (name): - Committee Chair - Commissioner - Secretary (Write full name and signature) COMMITTEE CHAIR DEAN OF INSTITUTE OF ENVIRONMENTAL SCIENCE, ENGINEERING AND MANAGEMENT ACKNOWLEDGMENT First of all, I would like to thank Dr Trinh Ngoc Nam and Prof Eppe, who were give me many useful instructions, suggestions and advices to complete this thesis And they were also give me many documentation related to my research, which are really exciting and provide me many knowledge in my thesis Then, I really appreciate the support of Prof Le Hung Anh and Mr Thang (a manager of Nam Binh Duong Domestic Waste Treatment Plant), who gave me many advices and helped me contact with Nam Binh Duong Domestic Waste Treatment Plant to installed the wet anaerobic fermentation pilot and implemented the research Third, I would like to thank Industrial University of Ho Chi Minh and University of Liege gave me opportunity to complete this thesis and the master course Finally, sincerely thank my team members (Mr Rodolfo, Mr Trung, Mr Danh, Ms Van, Ms Chau), who were cooperate with me to had this successful research Author Nguyen Duy ABSTRACT Domestic waste is a current worrying situation in Vietnam Together with the economic development, population growth and the waste of resources in the living habits of people, the quantity of waste is increasing, composition increasingly complex and potentially more risk noxious to the environment and human health In fact, most domestic waste only land filled in the normal landfill with many disadvantages (waste the land, the stench affect to residential areas, could become the source of disease) The consequences have serious impacts to the environment and does not save this renewable materials One of the methods to recover energy and reuse organic waste with highly effective and applied in many developed countries is wet anaerobic fermentation system Wet anaerobic fermentation system has the opportunity to be an integral part of the solution to two of the most pressing environmental concerns of urban centers: waste management and renewable energy Through wet anaerobic fermentation system, organics are decomposed by specialized bacteria in an oxygen-depleted environment to produce biogas and a stable solid The biogas, which consists of up to 65% methane, can be combusted in a cogeneration unit and produce green energy The most important factor in wet anaerobic fermentation system is anaerobic microorganisms, so this thesis will focus on: - Isolated microorganisms in anaerobic sludge after fermentation domestic waste - Identify some species of anaerobic microorganisms that predominate during fermentation TABLE OF CONTENTS LIST OF FIGURES LIST OF TABLES ABBREVIATIONS INTRODUCTION The reason for choosing the topic Objectives of the study 10 Subjects and scope of the study .11 The methodology 11 CHAPTER LITERATURE REVIEWS 12 1.1 Solid waste situation 12 1.1.1 In developed countries 12 1.1.2 In Vietnam .14 1.2 Anaerobic digestion process 15 1.2.1 Stages of anaerobic digestion 16 1.2.1.1 Hydrolysis .16 1.2.1.2 Acidogenesis 17 1.2.1.3 Acetogenesis 17 1.2.1.4 Methanogenesis .18 1.2.2 Microorganisms in anaerobic digestion 19 1.2.2.1 Hydrolytic bacteria 20 1.2.2.2 Acetogenic bacteria .23 1.2.2.3 Methanogenic microorganisms .24 1.2.3 Factors that affect the anaerobic digestion process .25 1.2.3.1 pH 25 1.2.3.2 Temperature 26 1.2.3.3 Carbon/Nitrogen ratio 26 1.2.3.4 Retention time .27 1.2.3.5 Loading rate 27 1.3 Methods to identify microorganisms in Anaerobic Digestion 28 1.3.1 Traditional methods of culture and identification 28 1.3.2 Molecular techniques in ecology of anaerobic microorganisms 29 1.4 Conclusion 30 CHAPTER MATERIAL AND METHODS 31 2.1 Materials, pilot modeling and equipment 31 2.1.1 Materials 31 2.1.2 Pilot modeling .31 2.1.3 Equipment used to analysis samples in laboratory 32 2.2 Methods .33 2.2.1 Coning and quartering method to calculate solid waste composition 33 2.2.2 COD determined 35 2.2.3 Experiments implementation 35 2.2.3.1 DNA extraction .35 2.2.3.2 Gel electrophoresis .37 2.2.3.3 Microorganism identify by phylogenetic tree .39 2.2.3.4 Experiments conducting 40 CHAPTER RESULTS AND DISCUSSION 41 3.1 Solid waste composition 41 3.2 COD 41 3.2.1 COD in experiment 41 3.2.2 COD in experiment 42 3.3 Temperature .43 3.3.1 Temperature in experiment 43 3.3.2 Temperature in experiment 44 3.4 pH 44 3.4.1 pH in experiment 44 3.4.2 pH in experiment 45 3.5 Anaerobic microorganisms 46 3.5.1 Anaerobic bacteria density 46 3.5.2 Anaerobic yeast density .46 3.5.3 Anaerobic bacteria density and anaerobic yeast density conclusion 47 3.6 Anaerobic bacteria isolated .47 3.6.1 K1 bacteria strain 47 3.6.2 K2 bacteria strain 48 3.6.3 K3 bacteria strain 48 3.6.4 K4 bacteria strain 49 3.6.5 K5 bacteria strain 49 3.6.6 K6 bacteria strain 49 3.7 Microorganism identification 50 3.7.1 16S - rDNA characteristics of K1 bacteria strain 50 3.7.2 16S - rDNA characteristics of K3 bacteria strain 52 3.7.3 16S - rDNA characteristics of K4 bacteria strain 53 3.7.4 Microorganism identification result 55 CHAPTER CONCLUSIONS AND RECOMMENDATIONS .56 4.1 Conclusions .56 4.2 Recommendations .56 REFERENCES 58 LIST OF FIGURES Figure 1.1 Total AD installed capacity per country 13 Figure 1.2 Total AD installed capacity per million inhabitants 14 Figure 1.3 Composition of solid waste in Vietnam in 2008 and expected .14 Figure 1.4 Metabolic pathways and microbial groups involved in anaerobic digestion 16 Figure 1.5 Overall process of anaerobic decomposition 21 Figure 1.6 Effect of the loading rate above the sustainable 28 Figure 2.1 Large pilot model in Nam Binh Duong Waste Disposal Plant .31 Figure 2.2 Small pilot model in laboratory of Industrial University Of Ho Chi Minh City 32 Figure 2.3 Thermo meter 33 Figure 2.4 pH meter 33 Figure 2.5 Coning and quartering method 33 Figure 2.6 Municipal waste was divided into part .34 Figure 2.7 Waste was classified 34 Figure 2.8 Gel electrophoresis 37 Figure 2.9 Restriction enzyme 38 Figure 2.10 Automation 39 Figure 2.11 Sequencing modify by FinchTV and SEAView software 39 Figure 2.12 Phylogenetic tree by MEGA software 40 Figure 3.1 Percentage of components in domestic waste 41 Figure 3.2 COD concentration in experiment 42 Figure 3.3 COD concentration in experiment 43 Figure 3.4 Temperature in experiment 43 Figure 3.5 Temperature in experiment 44 Figure 3.6 pH in experiment 45 Figure 3.7 pH in experiment 45 Figure 3.8 Anaerobic bacteria density 46 Figure 3.9 Anaerobic yeast density 46 Figure 3.10 Colonies (left) and Gram’s method (right) of K1 bacteria strain 47 Figure 3.11 Colonies (left) and Gram’s method (right) of K2 bacteria strain 48 Figure 3.12 Colonies (left) and Gram’s method (right) of K3 bacteria strain 48 Figure 3.13 Colonies (left) and Gram’s method (right) of K4 bacteria strain 49 Figure 3.14 Colonies (left) and Gram’s method (right) of K5 bacteria strain 49 Figure 3.15 Colonies (left) and Gram’s method (right) of K6 bacteria strain 50 Figure 3.16 Similarity ratio showed by color of K1 strain .51 Figure 3.17 Phylogenetic tree of K1 strain .51 Figure 3.18 Similarity ratio showed by color of K3 strain .52 Figure 3.19 Phylogenetic tree of K3 strain .53 Figure 3.20 Similarity ratio showed by color of K4 strain .54 Figure 3.21 Phylogenetic tree of K4 strain .54 LIST OF TABLES Table 1.1 Acetogenic dehydrogenation reactions .19 Table 1.2 Methane producing reactions 19 Table 1.3 Groups of bacteria according to their response to free molecular oxygen 20 Table 2.1 List of equipment used in laboratory 32 ABBREVIATIONS AD Anaerobic digestion BOD Biological oxygen demand CIAA Central Intercollegiate Athletic Association COD Chemical oxygen demand CTAB Cetyl trimethyl ammonium bromide DGGE Denaturing gradient gel electrophoresis DNA Deoxyribonucleic acid EDTA Ethylene diamine tetraacetic acid FISH Fluorescent in situ hybridization LPBM Local Probe Based Methods mRNA Messenger Ribonucleic acid MSW Municipal solid waste OHPAs Obligatory hydrogen producing acetogens PCR Polymerase chain reaction rDNA Ribosomal Deoxyribonucleic acid rRNA Ribosomal Ribonucleic acid TE Tris - Ethylene diamine tetraacetic acid TGGE Temperature gradient gel electrophoresis T-RFLP Terminal restriction fragment length polymorphism USSR Union of Soviet Socialist Republics VFAs Volatile fatty acids 7.5 7.3 7.1 6.9 6.7 6.5 11 12 13 14 15 16 17 19 20 21 22 25 26 27 Figure 3.6 pH in experiment [1] 3.4.2 pH in experiment 8.2 7.8 7.6 7.4 7.2 10 12 16 Figure 3.7 pH in experiment [1] The range of acceptable pH for the bacteria participating in digestion is from 5.5 to 8.5, though the closer to neutral, the greater the chance that the methanogenic bacteria will function [11] So, in experiment 2, pH in the reactors are a little bit higher than in experiment But it still in the acceptable pH range 45 3.5 Anaerobic microorganisms After culture anaerobic microorganism in the nitrogen environment, there are kind of microorganism had been found: bacteria and yeast Below are the results of bacteria and yeast density 3.5.1 Anaerobic bacteria density 25 20 15 10 11 21 23 Figure 3.8 Anaerobic bacteria density [1] 3.5.2 Anaerobic yeast density 30 25 20 15 10 11 21 Figure 3.9 Anaerobic yeast density [1] 46 23 3.5.3 Anaerobic bacteria density and anaerobic yeast density conclusion The result above showed that developing chart of anaerobic bacteria and yeast are similar From first day to seventh day is the adaptation phase so density of microorganisms are not high After the seventh day, the growth phase of microorganisms started and continue to eleventh day In this phase, microorganisms use substrate to growth so COD concentration will decrease significantly After growth phase, most of substrate were used, microorganism move to balance phase because there are less substrate to feed and growth, microorganisms only maintain density When microorganisms treat most of COD, means there are no substrate to feed more, they will move to decline phase Most of microorganisms will die and the process ended 3.6 Anaerobic bacteria isolated After isolate anaerobic bacteria, there are strains had been recorded as below: 3.6.1 K1 bacteria strain K1 bacteria strain: this bacteria can release air bubble; when implanted on the surface of agar, this bacteria growth deep into the agar and release air bubble, so the agar is pushed up Yellow or white colonies The bacteria cells change to violet when used Gram’s method, positive gram This bacteria have spherical shape and no spores Figure 3.10 Colonies (left) and Gram’s method (right) of K1 bacteria strain [1] 47 3.6.2 K2 bacteria strain K2 bacteria strain: Yellow colonies at 2nd dates, but after 6th dates it change into green moss and growth deep into agar And then, the colonies become black The bacteria cells change to violet when used Gram’s method, positive gram This bacteria have spherical shape and ellipse shape and release spores Figure 3.11 Colonies (left) and Gram’s method (right) of K2 bacteria strain [1] 3.6.3 K3 bacteria strain K3 bacteria strain: Pink colonies The bacteria cells change to pink when used Gram’s method, negative gram This bacteria have rods shape and no spores Figure 3.12 Colonies (left) and Gram’s method (right) of K3 bacteria strain [1] 48 3.6.4 K4 bacteria strain K4 bacteria strain: White colonies It growth up in the surface of agar The bacteria cells change to violet when used Gram’s method, positive gram This bacteria have multispherical shape and release spores Figure 3.13 Colonies (left) and Gram’s method (right) of K4 bacteria strain [1] 3.6.5 K5 bacteria strain K5 bacteria strain: White colonies The bacteria cells change to violet when used Gram’s method, positive gram This bacteria have circle shape or ellipse shape with the violet outline Figure 3.14 Colonies (left) and Gram’s method (right) of K5 bacteria strain [1] 3.6.6 K6 bacteria strain K6 bacteria strain: Transparent colonies The bacteria cells change to pink and violet when used Gram’s method There are kind of bacteria in this strain: Pink gram and 49 violet gram Pink gram: negative gram with a large quantity and in rods shape Violet gram: positive gram with a smaller quantity and in oval shape Figure 3.15 Colonies (left) and Gram’s method (right) of K6 bacteria strain [1] 3.7 Microorganism identification 3.7.1 16S - rDNA characteristics of K1 bacteria strain The sequence of 16S-rDNA partial AATACTACAGCGAGCACGCCGCGTGAGTGATGAAGGTTTTCGGATCGTAAA GCTCTGTTGTTAGGGAAGAACAAGTACCGTTCGAATAGGGCGGTACCTTGAC GGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTAAT ACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGCAGG CGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATT GGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATGTGTAG CGGTGGAATA Similarity ratio of bacteria strains is showed by color in Genbank (Red means high similarity ratio) 50 Figure 3.16 Similarity ratio showed by color of K1 strain [1] The sequencing had been compared similarity ratio by NCBI (BLAST) to found out other sequencing, which have high similarity ratio Then, sequencing had been used to draw phylogenetic tree as below: Bacillus tequilensis Bacillus mojavensis Bacillus licheniformis K1 Bacillus subtilis Figure 3.17 Phylogenetic tree of K1 strain [1] The result after read and link nucleotide of K1 strain are 318 Nu This result is match with data of Genbank (BLAST) Figure 3.17 showed that K1 strain is Bacillus subtilis strain with bootstrap 100 51 3.7.2 16S - rDNA characteristics of K3 bacteria strain The sequence of 16S-rDNA partial AATGCACCCGCAGCACGCCGCGTGAGTGATGAAGGTTTTCGGATCGTAAAGC TCTGTTGTTAGGGAAGAAAAGTACCGTTCGAATAGGGCGGTACCTTGACGGT ACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTAATACG TAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGCAGGCGGT TTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAA ACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATGTGTAGCGGT GGAAT Similarity ratio of bacteria strains is showed by color in Genbank (Red means high similarity ratio) Figure 3.18 Similarity ratio showed by color of K3 strain [1] The sequencing had been compared similarity ratio by NCBI (BLAST) to found out other sequencing, which have high similarity ratio Then, sequencing had been used to draw phylogenetic tree as below: 52 K3 Bacillus subtilis Bacillus tequilensis Bacillus Bacillus licheniformis Figure 3.19 Phylogenetic tree of K3 strain [1] The result after read and link nucleotide of K3 strain are 315 Nu This result is match with data of Genbank (BLAST) Figure 3.19 showed that K3 strain is Bacillus subtilis strain with bootstrap 100 3.7.3 16S - rDNA characteristics of K4 bacteria strain The sequence of 16S-rDNA partial GGTGCTCTGACGGAGCACGCCGCGTGAGTGATGAAGGCTTTCGGGTCGTAAA ACTCTGTTGTTAGGGAAGAACAAGTGCTAGTTGAATAAGCTGGCACCTTGAC GGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTAAT ACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGG TGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATT GGAAACTGGGAGACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATGTGTGC CGGTGGAATT Similarity ratio of bacteria strains is showed by color in Genbank (Red means high similarity ratio) 53 Figure 3.20 Similarity ratio showed by color of K4 strain [1] The sequencing had been compared similarity ratio by NCBI (BLAST) to found out other sequencing, which have high similarity ratio Then, sequencing had been used to draw phylogenetic tree as below: K4 Bacillus cereus Bacillus endophyticus Bacillus licheniformis Bacillus pumilus Figure 3.21 Phylogenetic tree of K4 strain [1] The result after read and link nucleotide of K4 strain are 319 Nu This result is match with data of Genbank (BLAST) Figure 3.21 showed that K4 strain is Bacillus cereus strain with bootstrap 84 54 3.7.4 Microorganism identification result The results above showed that K1, K3, K4 are anaerobic bacteria K1 and K3 is one species: Bacillus subtilis K4 is Bacillus cereus - Some characteristic of Bacillus subtilis found in GenBank: + Bacillus subtilis has been isolated from fruit shells, which are berries and seed such as tomatoes, grapes, bananas, coffee seed or eggs of crustaceans (shrimp, crabs, lobsters, crayfish, krill, woodlice, …) + Bacillus subtilis has strong enzyme, especially: pectolase enzyme, cellulose enzyme, xylanase enzyme, amylase enzyme + Bacillus subtilis belong to the surface bacteria group + Bacillus subtilis is anaerobic bacteria, they break down the greasy components, especially palm oil Gram-positive, rod-shaped - Some characteristic of Bacillus cereus found in GenBank: + Bacillus cereus has been isolated from agricultural waste + Bacillus cereus is a strong hydrolysis bacteria, they can hydrolysis lignocellulose They ferment glucose in both aerobic and anaerobic to release acetic acid and lactic acid 55 CHAPTER CONCLUSIONS AND RECOMMENDATIONS 4.1 Conclusions The optimal conditions of characteristic in anaerobic fermentation process are: temperature (35oC for mesophilic and 55oC for thermophilic); pH (from to 7.2); C/N ratio (25/1); and presence of four bacteria group: hydrolysis, acidification, acetogens, methanogens The research had achieved targets: monitor some main parameters as temperature, pH, COD concentration; survey aerobic and anaerobic microorganism density; isolated bacteria strains; extraction DNA and identified anaerobic bacteria strains After identified anaerobic bacteria strains, the results as below: Bacillus subtilis (hydrolysis microorganisms, decomposes substances contain oils, glucose, cellulose) and Bacillus cereus (acidification microorganisms, the main product of this group is acetic acid – the source of 70% methane) With the result after analyzed the biogas contents, this is a opportunity to recover methane from domestic waste and convert into energy in Vietnam This is also a good solution to treat domestic waste and reduce the amount of waste released Biogas efficiency depends on many conditions But these conditions could be control to get a high efficiency such as: provide a high temperature for the fermentation process to conduct in thermophilic condition; stir the anaerobic digestion tank; provide the anaerobic microorganisms to help the fermentation process occur faster 4.2 Recommendations With the good result of this research, we would suggest some contents for the next research to apply anaerobic wet fermentation process in Vietnam as below: - Improve the technology and provide optimum conditions for the anaerobic wet fermentation process - Culture two bacteria strains, which we had isolated and provide for next researches to help the fermentation occur faster and increase the biogas efficiency - Using the cow dung to provide anaerobic bacteria for fermentation process to save time instead waiting for them appears naturally Because cow dung has a lot of anaerobic bacteria, which are good for fermentation process 56 - Research with a bigger and more professional pilots and apply for some large domestic waste treatment plant in Vietnam - Isolate and identify more anaerobic bacteria strains Then we could culture them and produce a kind of probiotics in future 57 REFERENCES [1] [2] This work is made by the author Arthur Isaac Kendall, Marjorie Cook and Marjorie Ryan Methods of Isolation and Cultivation of Anaerobic Bacteria Oxford University Press, [3] 2015, pp.227-234 Carlos Augusto de Lemos Chernicharo “Volume four- Anaerobic Reactors”, Biological Wastewater treatment series IWA Publishing, 2007, pp.1-152 [4] Christy E Manyi-Loh et al Microbial Anaerobic Digestion (Bio- Digesters) as an Approach to the Decontamination of Animal Wastes in Pollution Control and the Generation of Renewable Energy International Journal of Environmental Research and Public Health, 2013, pp.43904408 [5] Dieter Deublein and Angelika Steinhauser Biogas from Waste and Renewable Resources WILEY-VCH Verlag GmbH & Co KGaA, 2008, pp.49-137 [6] Dimitar Karakashev et al Applied and environmental microbiology Vol 71 American Society for Microbiology, 2005, pp.331-338 Gabriel Bitton Wastewater Microbiology-Third edition John Wiley & Sons, 2005, pp.3-173 Gareth M Evans and Judith C Furlong Environmental Biotechnology Theory and Application John Wiley & Sons, 2003, pp.11-48 Hans-Joachim Jördening and Josef Winter Environmental Biotechnology WILEY-VCH Verlag GmbH & Co KGaA, 2005, pp.1-131 I.L Pepper and C.P Gerba Environmental Microbiology – A Laboratory Manual Elsevier Inc, 2004, pp.3-184 Karena Ostrem Greening waste: anaerobic digestion for treating the organic fraction of municipal solid wastes Master thesis Columbia university, 2004, pp.1-50 [7] [8] [9] [10] [11] [12] [13] Katherine D Mc Mahon et al Anaerobic co-digestion of municipal solid waste and bio-solids under various mixing conditions - II: Microbial population dynamics Elsevier Science Ltd, 2001, pp.1817-1825 Lawrence K Wang et al Handbook of environmental engineering Environmental Biotechnology Springer Science + Business Media 2010, pp.395-434 58 [14] Ljupka Arsova Anaerobic digestion of food waste: Current status, problems and an alternative product Earth Engineering Center, Columbia University, 2010, pp.1-24 [15] Luc De Baere and Bruno Mattheeuws Anaerobic Digestion of the Organic Fraction of Municipal Solid Waste in Europe Research Gate, 2012, pp.517-526 [16] Manfred Lubken et al Modelling the energy balance of an anaerobic digester fed with cattle manure and renewable energy crops Elsevier Inc, 2007, pp.4085-4096 [17] Martin Garcia-Varela et al Phylogenetic Relationships of Acanthocephala Based on Analysis of 18S Ribosomal RNA Gene Sequences Springer[18] Verlag New York Inc, 2000, pp.532-540 Michael H Gerardi The Microbiology of Anaerobic Digesters John Wiley & Sons, 2003, pp.3-51 [19] Mohamed Abdallah and Kevin Kennedy “Chapter 7: Advanced [20] Monitoring and Control of Anaerobic Digestion in Bioreactor Landfills” Biodegradation - Engineering and Technology Intech, 2013, pp.161-187 Samir Kumar Khanal Anaerobic Biotechnology for Bioenergy Production John Wiley & Sons, 2008, pp.29-112 [21] [22] [23] [24] T Srinivas Environmental Biotechnology New Age International Publishers, 2008, pp.1-107 Vietnam National state of environment “Chapter 6: Solid waste”, Green cities – Plan for the planet! Pp.109-121, June, 2005 Vogeli Y., et al Anaerobic Digestion of Biowaste in Developing Countries: Practical Information and Case Studies Sandec: Department of Water and Sanitation in Developing Countries, 2014, pp.11-44 Eija Alakangas (2015, Oct.) “Quality guidelines of wood fuels in Finland VTT-M-04712-15.” Reasearch gate [Online] pp 36 Available: https://www.researchgate.net/publication/283496833 [25] “DNA Sequencing and Digital DNA.” Internet: http://universereview.ca/R11-16-DNAsequencing.htm#gel, Mar 2008 59 ... growth and the waste of resources in the living habits of people, the quantity of waste is increasing, composition increasingly complex and potentially more risk noxious to the environment and human... remain scattered, making management difficult and resulting in a waste of land Landfilling is the main form of municipal waste treatment with landfill/municipality on average (4-5 landfills/treatment... materials [15] Major progress was made in all areas of waste management but the introduction of anaerobic digestion into the treatment of MSW is one of the most successful and innovative technology