g protein signaling, methods and protocols
... Smrcka G Protein Signaling VOLUME 237 Methods and Protocols Edited by Alan V. Smrcka Methods and Protocols G Protein Signaling G Protein Subunit Purification from Sf9 Cells 21 21 From: Methods ... downstream effectors. GTP on G is hydrolyzed to GDP by its own GTPase activity as well as GTPase-activating proteins, such as regulator of G protein signaling (RGS) pr...
Ngày tải lên: 10/04/2014, 22:24
... Targeting Vectors 2.2.1. Cloning of Genomic DNA Coding a Target Gene A genomic DNA coding the gene of interest for constructing a targeting vec- tor is needed. A genomic library from the same ... the digestion with EcoRI and PstI, the wild-type allele shows 2670 bp band and the knockout allele shows 2430 bp. 3. Methods 3.1. Heterozygous Gene Targeting 3.1.1. Transfection of a Targeting...
Ngày tải lên: 10/04/2014, 11:11
protein arrays, methods and protocols
... (His) 6 tag, followed by two stop codons, a poly (A) tail, and a transcrip- tion termination region (6). The DNA sequence is GCTCTAGAggcggtggctctggtg gcggttctggcggtggcaccggtggcggttctggcggtggcAAACGGGCTGATGC TGCACATCACCATCACCATCACTCTAGAGCTTGGCGTCACCCG CAGTTCGGTGGTCACCACCACCACCACCACTAATAA(A) 28 CCGCTGAGCAA TAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTT TGCTGAAAGGAGGAACTATATCCGGA-3'. .....
Ngày tải lên: 11/04/2014, 10:11