where is your school

Giao an anh 6 standard

Giao an anh 6 standard

... This is Songs family There are four people in his family This is his father His name is Kien He is a doctor He is 42 years old This is his mother Her name is Oanh She is a nurse She is ... this / desk? Is this your desk? X That / desk No That is my desk c Model * This is my school. / That is my class * A: Is this your desk? B: Yes, it is A: Is that your class? B: No, it isnt 17 LESSON ... small ? Yes ,it is - Is Thus school small ? No ,it isnt - T gives word cue drills :Phongs school /Thus school /your school /your house / your brothers school / your sisters school / big /small...

Ngày tải lên: 20/10/2014, 21:00

66 312 0
Giáo Án Unit 6 : Around the house C1 - C2

Giáo Án Unit 6 : Around the house C1 - C2

... questions : 1 .Where is the chicken ? 2 .Where are the mountains ? - It is to the left of the chair - They are behind the house Trang 3 .Where is the car ? 4 .Where is the ball ? - It is to the right ... answers : 1 .Where is the yard ? It is in front of the house 2 .Where are the tall trees ? They are behind the house 3 .Where are the mountains ?- They are behind the tall trees 4 .Where is the well ... the tall trees 4 .Where is the well ? It is to the left of the house Where are the flowers ? They are to the right of the house 6 .Where is the house ? It is between the well and the flowers c...

Ngày tải lên: 13/10/2013, 21:11

9 803 5
Phrasal Verbs Pre-Inter Advance - Around the house

Phrasal Verbs Pre-Inter Advance - Around the house

... been knocked over In A, there is a new bell; in B, there is an old bell In A, the sail is up; in B, the sail is down In A, the sailor has got bare feet; in B he is , wearing sandals In A, you ... feather is falling from the parrot; in B the feather is on the floor (apple) Both A and B have an apple on a plate In A the apple is whole; in B only the core is left (bird) In A, the parrot is fat, ... the smoke rises from the chimney vertically; in B it rises in a wavy line (grass) In A the grass is wild and long; in B it has been mown (book) In A, the book is a cookery book; in B it is a children's...

Ngày tải lên: 01/11/2013, 16:20

15 342 1
Tài liệu Pests around the house pptx

Tài liệu Pests around the house pptx

... various diseases, including serious food poisoning Remedy: Control is seldom easy because it is difficult to get the insecticide to the insect The insecticide should have sufficient persistence ... the last place that it visited - which could have been anywhere from a dustbin to animal droppings! Remedy: Scrupulous hygiene and prompt disposal of all rubbish will discourage flies Keep food ... The first order of business is to clean stored clothes It is important to identify the source of infestation Besides looking where clothes are stored, look around your baseboards for fluff At...

Ngày tải lên: 15/12/2013, 11:15

6 362 0
spanish around the house

spanish around the house

... 201 Appendix C: Dictionary 203 English-Spanish 203 Spanish-English 238 Index 273 This page intentionally left blank Introduction Spanish Around the House is a comprehensive, easy-to-follow book ... English The Spanish used in this book is standard Spanish that can be understood by any native speaker of the language It would be impossible to cover all the regionalisms found in the Spanish-speaking ... be a valuable source of regionalisms from their country of origin The English-Spanish/Spanish-English dictionary in Appendix C of this book focuses on the Spanish used at home or in home-related...

Ngày tải lên: 04/05/2014, 12:54

300 482 0
Báo cáo khoa học: Structural mobility of the monomeric C-terminal domain of the HIV-1 capsid protein pptx

Báo cáo khoa học: Structural mobility of the monomeric C-terminal domain of the HIV-1 capsid protein pptx

... diffusion tensor (e.g the diffusion tensor of CACW40A is fully anisotropic) because it is well-known that simplified isotropic models in which anisotropy is neglected can wrongly lead to exchange terms ... and, thus, the model-free formalism cannot be rigorously applied This is not the sole example where the use of the model-free formalism has been unsuccessful: this approach cannot be applied on ... interface displays a high flexibility, but also that the rest of the protein is affected by movements on the pico-to-millisecond time regime This mobility, as shown by the dimeric non-mutated CAC, is...

Ngày tải lên: 07/03/2014, 06:20

13 421 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

... primers Methods for RNA isolation, first-strand DNA synthesis, etc have been published previously [33] After isolation, RNA was treated with RNase-free DNase (Sigma Chemicals, St Louis, USA) to remove ... obtained with RNA isolated from GFP–Hippi-expressing HeLa cells was increased 2.5-fold in comparison to the value obtained when RNA from the HeLa cells was used This increase was statistically significant ... HIP1 [24] On the basis of this observation, we hypothesized that HIP1 might play similar role in the transport of HIPPI into the nucleus We are presently testing this hypothesis The role of HIPPI...

Ngày tải lên: 07/03/2014, 10:20

14 393 0
Báo cáo khoa học: Prevalence of intrinsic disorder in the hepatitis C virus ARFP/Core+1/S protein doc

Báo cáo khoa học: Prevalence of intrinsic disorder in the hepatitis C virus ARFP/Core+1/S protein doc

... IDPs This character is also confirmed by disorder and structure predictions based on protein sequences This is not the first time that an HCV protein has been reported to be at least partially disordered ... 6–28 and 42–58 for HCV1b Core+1/S, whereas pondr suggested that most of the Core+1/S sequence is disordered In order to assess whether the disorder prediction is also confirmed by the absence of ... structure propensity This observation suggests that the detected b-sheet signal could be due to partial oligomerization of the natively disordered HCV Core+1/S proteins This hypothesis is also supported...

Ngày tải lên: 15/03/2014, 09:20

16 498 0
C#1 introduction to programming and the c language potx

C#1 introduction to programming and the c language potx

... program is inished and can be tested From the menu you select Debug | Start Without Debugging Explanation Note irst that C# is case-sensitive, so that everywhere you have to distinguish between ... programming It is thus not a prerequisite that the reader has knowledge of programming, but only that the reader is interested in programming and would have Visual Studio installed on his computer ... disadvantages, the similarities outweighs the diferences, and once you have learned one language, it is easy to learn the next hroughout this book the programming language C# is used, which is...

Ngày tải lên: 18/03/2014, 02:20

30 539 0
Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

... C53 (sense) C203 (antisense) N294 (sense) N295 (antisense) N246 (sense) N247 (antisense) N298 (sense) N300 (antisense) N222 (antisense) C54 (antisense) GTGCTTGCGAATTCCCCGGGA CTCGAATTCAGTTGACGCCGTCTTCCAGAACC ... metabolism [68] Any putative implication of core+1 in lipid metabolism would be intriguing inasmuch as HCV replication is associated with the modulation of multiple genes involved in lipid metabolism ... myc – 342–825 pHPI-1494 (pcDNA3.1(–) ⁄ Myc-His) pHPI-1507 (pcDNA3.1(–) ⁄ Myc-His) pHPI-1495 (pcDNA3.1(–) ⁄ Myc-His) pHPI-1705 (pcDNA3.1(–) ⁄ Myc-His) Mutation Tag molecule Length of the HCV-1...

Ngày tải lên: 30/03/2014, 03:20

18 365 0
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

... Nadia Rabah is a recipient of a Fonds de la ´ ´ recherche en sante du Quebec (FRSQ) studentship award and is registered at the Division of Experimental Medicine of McGill University This study was ... vector The resulting C-terminally His-tagged protein was expressed in Escherichia coli strain BL21 (DE3) (Novagen, Mississauga, Canada) after induction with mm isopropyl-1-thio-b-d-galactopyranoside ... Acknowledgements We wish to thank Dr Bernard F Gibbs (MDS-Pharma ´ ´ Services, Montreal, Quebec, Canada) for granting us access to the mass spectrometer used in this study and for his expertise We thank...

Ngày tải lên: 30/03/2014, 08:20

10 305 0
Báo cáo khoa học: The C-terminal region of CHD3/ZFH interacts with the CIDD region of the Ets transcription factor ERM and represses transcription of the human presenilin 1 gene pot

Báo cáo khoa học: The C-terminal region of CHD3/ZFH interacts with the CIDD region of the Ets transcription factor ERM and represses transcription of the human presenilin 1 gene pot

... the GAL4–HIS3 reporter gene is leaky in AH109: a low level of expression occurs in the absence of GAL4 activation 3-Amino-1,2,4-triazole (3-AT; an inhibitor of histidine biogenesis) is used to ... PS1 is repressed by p53 and the cofactor p300 [45] It is possible that CHD3 participates in the repression of PS1 in vivo via mechanisms including some of the aspects outlined above Such mechanisms ... ERM-delineated sequences required for interaction with CHD3 between residues 279 and 299, and this is consistent with the effects of N-terminal deletions of ERM However N-terminal deletions of ERM...

Ngày tải lên: 30/03/2014, 09:20

15 324 0
Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx

Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx

... Clinical manifestations range from mild disease, including rhinitis, pharyngitis, and otitis media, to more severe disease, including croup, bronchiolitis, and pneumonia [1-6] Collectively, human ... Amaro-Carambot for assistance with sequencing We are grateful to Pamela Shaw and Dean Follman for assistance with statistical analysis We also thank Brad Finneyfrock and Marisa St Claire at Bioqual ... versus 32°C is greater than or equal to the indicated value There is no S.E value for viruses at the limit of detection b Viruses contained the CR84G mutation, although this latter mutation is phenotypically...

Ngày tải lên: 18/06/2014, 18:20

13 504 0
Báo cáo hóa học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" docx

Báo cáo hóa học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" docx

... Clinical manifestations range from mild disease, including rhinitis, pharyngitis, and otitis media, to more severe disease, including croup, bronchiolitis, and pneumonia [1-6] Collectively, human ... Amaro-Carambot for assistance with sequencing We are grateful to Pamela Shaw and Dean Follman for assistance with statistical analysis We also thank Brad Finneyfrock and Marisa St Claire at Bioqual ... versus 32°C is greater than or equal to the indicated value There is no S.E value for viruses at the limit of detection b Viruses contained the CR84G mutation, although this latter mutation is phenotypically...

Ngày tải lên: 20/06/2014, 01:20

13 520 0
what a world 1 - amazing stories from around the globe

what a world 1 - amazing stories from around the globe

... care for over 200 million cows every year They have cared for cows for a long time It is a tradition that is thousands of years old Unit ... farmers not make a lot of money They can't buy machines to help them their work Also, the weather is a problem in India In June, July, August, and September, there's a lot of rain The ground gets ... celebrations are like Thanksgiving in the United States Old cows cannot work on farms In India, it is against the law to kill a cow So farmers send their old cows away from the farm The cows walk...

Ngày tải lên: 17/07/2014, 18:49

139 1,2K 2
w