using the naming service from a c client

Tài liệu Lab 1.1.7 Using ping and tracert from a Workstation ppt

Tài liệu Lab 1.1.7 Using ping and tracert from a Workstation ppt

... Trace the route to the Cisco web site Type tracert www.cisco.com and press Enter 4-5 CCNA 1: Networking Basics v 3.0 - Lab 1.1.7 Copyright  2003, Cisco Systems, Inc tracert is TCP/IP abbreviation ... 12 Trace a local host name or IP address Try using the tracert command with a local host name or IP address It should not take long because the trace does not pass through any routers Reflection ... replies as the ping command but in a slightly different way Observe that tracert actually contacted each router three times Compare the results to determine the consistency of the route Notice in the...

Ngày tải lên: 11/12/2013, 13:15

5 500 1
Tài liệu Lab 1.1.7 Using ping and tracert from a Workstation pdf

Tài liệu Lab 1.1.7 Using ping and tracert from a Workstation pdf

... Trace a local host name or IP address Try using the tracert command with a local host name or IP address It should not take long because the trace does not pass through any routers 5-6 CCNA 1: ... because the command language did not like the space in the name Step ping the Cisco web site Type the following command: ping www.cisco.com 3-6 CCNA 1: Networking Basics v 3.0 - Lab 1.1.7 Copyright ... 4-6 CCNA 1: Networking Basics v 3.0 - Lab 1.1.7 Copyright  2003, Cisco Systems, Inc Step 10 Trace the route to the Cisco web site Type tracert www.cisco.com and press Enter tracert is TCP/IP abbreviation...

Ngày tải lên: 21/12/2013, 19:15

6 419 0
TYING ODYSSEUS TO THE MAST: EVIDENCE FROM A COMMITMENT SAVINGS PRODUCT IN THE PHILIPPINES* pot

TYING ODYSSEUS TO THE MAST: EVIDENCE FROM A COMMITMENT SAVINGS PRODUCT IN THE PHILIPPINES* pot

... (hundreds) Active account Barangay’s distance to branch Bank’s penetration in barangay Standard deviation of balances in barangay (hundreds) Mean savings balance in barangay (hundreds) Population of barangay ... the impact of the savings product on financial savings held at the financial institution (both in the SEED account and in other accounts) We measure change in total balances held in the financial institution ... change in balance on the indicator variables for the treatment groups and the binary variable for active client status We then compare the coefficient estimates against the ITT coefficient estimates...

Ngày tải lên: 06/03/2014, 10:20

38 523 0
The Economic Crisis from a Neoclassical Perspective pptx

The Economic Crisis from a Neoclassical Perspective pptx

... Given that a financial crisis clearly did occur, one important question is why the financial crisis, at least from the perspective of aggregate data as reflected in the neoclassical business cycle ... thus inconsistent with a central assumption in the financial explanation The financial explanation also argues that the 2007–2009 recession became much worse because of a significant contraction ... of economic fluctuations by constructing a neoclassical business cycle model, feeding in data from cyclical episodes, and then measuring the deviations in the equations that characterize the...

Ngày tải lên: 08/03/2014, 06:20

22 835 0
báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot

báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot

... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... GGTCGGCGCGTGGGAGTACTGCAAGCAGCTCACCTACAAGGCCGGGGTGTCCTCGCCGCCGGCGTGCCCGGCCGTGAACGTGGCCAGCCACGCGTGCCAG : 100 GGTCGGCGCGTGGGAGTACTGCAAGCAGCTCACCTACAAGGCCGGGGTGTCCTCGCCGCCGGCGTGCCCGGCCGTGAACGTGGCCAGCCACGCGTGCCAG : 100 GGTCGGCGCGTGGGAGTACTGCAAGCAGCTCACCTACAAGGCCGGGGTGTCCTCGCCGCCGGCGTGCCCGGCCGTGAACGTGGCCAGCCACGCGTGCCAG ... GAGGAGGTCAGCTTCGCCGTCACGGTGGCCAACACGGGCGGCAGGGACGGCACCCACGTCGTGCCGGTGTACACGGCGCCGCCGGCCGAGGTGGACGGCG : 200 GAGGAGGTCAGCTTCGCCGTCACGGTGGCCAACACGGGCGGCAGGGACGGCACCCACGTCGTGCCGGTGTACACGGCGCCGCCGGCCGAGGTGGACGGCG :...

Ngày tải lên: 12/08/2014, 03:20

10 250 0
Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx

Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx

... positively associated with low back pain, in particular with chronic or recurrent low back pain [27] What appears to be a main concern in linking obesity as a causal factor for low back pain is the ... that contributions from both local increased force across the joint and systemic factors play a role [9] A discriminating factor between fit and unfit patients with back pain may be the fact ... examine the source As an example of an evidence summary see Table It is at this time that the clinician is ready for the final step of applying the evidence In our example clinical data from the...

Ngày tải lên: 13/08/2014, 13:22

6 402 0
Báo cáo y học: "Where does the lactate come from? A rare cause of reversible inhibition of mitochondrial respiration" pdf

Báo cáo y học: "Where does the lactate come from? A rare cause of reversible inhibition of mitochondrial respiration" pdf

... prompt therapy [13] To conclude, when looking at the literature, pure hypoxic causes of lactic acidosis are relatively rare in clinical practice In the case of biguanide-induced lactic acidosis, the ... Unfortunately, arterial lactate/pyruvate and acetoacetate/ β-hydroxybutyrate ratios, as reflections of cytoplasmic and mitochondrial redox states, were unavailable Interestingly, there was a clear correlation ... take vitals, take a lactate Intensive Care Med 2007, 33:1863-1865 Levy B, Gibot S, Franck P, Cravoisy A, Bollaert PE: Relation between muscle Na+K+ ATPase activity and raised lactate concentrations...

Ngày tải lên: 13/08/2014, 20:21

2 233 0
Using the delphi method as a form of assessment

Using the delphi method as a form of assessment

... each standard • Used as a source document ACCE Standard Accreditation standards listed Sources of Evidence Program Goal One: The Graduate Will Communicate Effectively Faculty reported having reviewed ... participate • Can be managed electronically, without requirement that all participants sit in one room at the same time Case Study: Construction Management Assessment Study • Its program accreditor, ... strengths and weaknesses listed according to ACCE standard • Some statement combined if sufficiently the same • According to each standard, list is created Those with like statements (coming from separate...

Ngày tải lên: 24/10/2014, 00:07

16 313 0
conference interpreting in the vietnamese context from a pragmatic perspective = nghiên cứu phiên dịch hội nghị trong bối cảnh việt nam từ quan điểm dụng học

conference interpreting in the vietnamese context from a pragmatic perspective = nghiên cứu phiên dịch hội nghị trong bối cảnh việt nam từ quan điểm dụng học

... particular emphasis on the role of context and the dynamics of interactivity in face-to-face communication Taking a descriptive discourseanalytical approach to her data, Wadensjo showed that the ... idea, Grice opened the way for an inferential alternative to the classical code model of communication According to the classical view, utterances are signals encoding the messages that speakers ... interpreting as human information processing had also included a crucial admonition to take account of factors beyond the cognitive mechanics as such: "Furthermore, linguistic, motivational, situational,...

Ngày tải lên: 02/03/2015, 14:17

272 658 5
Exploring the environmental variable from a cultural perspective through wayfinding behavior based on three chinese hospitals case studies

Exploring the environmental variable from a cultural perspective through wayfinding behavior based on three chinese hospitals case studies

... for further research Chapter examines the cultural aspects in the Chinese architecture It is composed of Chinese spatial concept and architectural patterns This chapter The detailed statements ... elaborated in the following Chapter 16 clarified the social-cultural aspects of the Chinese architecture Chapter proposes a theoretical framework of wayfinding theory is integrated cultural aspects ... design facilities such as ramps and handrails On the other hand, hardly anyone could deny that psychological accessibility is also a valuable and desirable quality in health care facilities.(Bell...

Ngày tải lên: 05/10/2015, 22:31

161 285 0
AN0808   using the TC1142 for biasing a gaas power amplifier

AN0808 using the TC1142 for biasing a gaas power amplifier

... frequencies, and higher poweradded efficiency allow the cellular user increased talk time as compared to silicon PAs © 2002 Microchip Technology Inc GaAs PAs require a negative DC bias, and the TC1142 ... 0.47µF flying capacitors (C1 , C2 ) and the 4.7µF output capacitor (COUT) are the only external components required The output current is a function of the C1 , C2 flying capacitors, and the output ... portable applications Table shows the relationship between output voltage ripple versus the two flying capacitors (C1 and C2 ) and the output capacitor (COUT) In each case, a 3.2V input is being converted...

Ngày tải lên: 11/01/2016, 14:26

6 217 0
Ace the IELTS tips from a teacher ( Greene Philip )

Ace the IELTS tips from a teacher ( Greene Philip )

... teams (but you can this by yourself with a few pieces of paper) and each team would have one main character as their mascot Each time a new piece of information connected to the plot was revealed, ... self-conscious about their accents when speaking a foreign language This is understandable - we all want to fit in and having an accent marks us as being from another place My students always asked ... idea of the text was This is, to say the least, the wrong approach Practice the following exercises with each text First, read the first and last sentence of each paragraph This is where all the...

Ngày tải lên: 13/06/2016, 09:10

23 516 0
Expert Service Oriented Architecture in C Sharp  Using the Web Services Enhancements

Expert Service Oriented Architecture in C Sharp Using the Web Services Enhancements

... reliability and scalability because they can be stored, and the services that process the messages can append additional information, which provides for a clear and unambiguous chain of custody across ... “Introducing Service- Oriented Architecture”: This chapter introduces the concepts behind service- oriented architecture, and the characteristics of a Web service from the perspective of SOA This chapter ... as a Web-enabled service, then it needs to clearly document how the service must be called SOA will address many of the availability and scalability issues in today’s applications Most applications...

Ngày tải lên: 20/08/2012, 13:59

336 842 2
Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt

Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt

... vector pYES2 (Invitrogen, Carlsbad, CA, USA), 4390 and the two synthesized oligonucleotides Phis (5Â-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3Â) and PMluI (5Â-GTACACGCG TCTGATCAG-3Â) ... electrotransblotting apparatus (Nova Blot, Amersham Pharmacia Biotech, Piscataway, NJ, USA) The blots were incubated with the rabbit polyclonal antibody raised against the MAP (Mitogen-activated ... luminal sides In addition, the theoretical ratio of the total amount of amino acids on the cytosolic and luminal sides was calculated as 2.31 : (data not shown), verifying the efcacy of this technique...

Ngày tải lên: 16/03/2014, 02:20

14 332 0
w