universal serial bus a serial interface for connecting peripheral

dictionary of e-business [electronic resource] a definitive guide to technology and business terms

dictionary of e-business [electronic resource] a definitive guide to technology and business terms

... America, Far East, and in the Asia Pacific region including Australia and New Zealand In the Asia Pacific country of Japan, NTT’s MCS system was the first commercial delivery of a mobile 1G Japanese ... languages such as C++, Java and Visual Basic, and even in machine code or assembly language Any high-level programming language that supports arrays may be used to develop graphics transformation ... that of an analogue audio signal The maximum frame capture rate of a video capture card is a function of its maximum sampling rate which is linked to the maximum data rate at which it can operate...

Ngày tải lên: 29/05/2014, 15:31

379 3,5K 0
Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf

Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf

... underlying database of movie information is stored in XML format When a new database is available, a Grammar Compiler component extracts and normalizes the relevant fields from the database These are ... overall 66% sentence accuracy and 76% word accuracy Task completion: Since participants had to record the task answers on a paper form, task completion was calculated by whether participants ... conjunction with a predefined multimodal grammar template and any available corpus training data to build a multimodal understanding model and speech recognition language model The user interacts with...

Ngày tải lên: 20/02/2014, 12:20

8 586 0
Báo cáo khoa học: "A speech interface for open-domain question-answering" doc

Báo cáo khoa học: "A speech interface for open-domain question-answering" doc

... interface is particularly applicable in a mobile context, in which text entry is slow and circumstances may prohibit speech altogether We fitted a 3-gram language model to the same corpus as above ... document retrieval track: A success story In Proc Content-Based Multimedia Information Access Conf., apr J Kupiec, D Kimber, and V Balasubramanian 1994 Speech-based retrieval using semantic co-occurrence ... orthographic forms would be trickier to implement but could also improve recall For example, Q245 What city in Australia has rain forests? it answered correctly, but the transcription What city in Australia...

Ngày tải lên: 08/03/2014, 04:22

4 276 0
Báo cáo khoa học: "From Information Structure to Intonation: A Phonological Interface for Concept-to-Speech" pot

Báo cáo khoa học: "From Information Structure to Intonation: A Phonological Interface for Concept-to-Speech" pot

... Figure 1: Architecture This architecture forms an ideal platform for the implementation of the phonological interface Necessary adaptions are limited to the data used: An existing grammar was extended ... grammatical representation via feature-filters There are few theoretical frameworks in computational linguistics for tackling such a breadth of phonological issues Linguistically ambitious approaches ... syntactic sugar enables us to keel) the rule formulations over the collapsed representation economical and relatively transparent We note in passing that although collapsing multilinear data-structures...

Ngày tải lên: 08/03/2014, 06:20

5 498 0
Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc

Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc

... e ı a Measures for Automatic Machine Translation Evaluation Machine Translation, 24(3–4):77–86 Ahmed El Kholy and Nizar Habash 2011 Automatic Error Analysis for Morphologically Rich Languages ... Error Analysis and Proposed Solutions for the Catalan—Spanish Language Pair LREC, 45(2):181–208 Mark Fishel, Ondˇej Bojar, Daniel Zeman, and Jan Berka r 2011 Automatic Translation Error Analysis ... Jos´ B c a e Mari˜ o, Deepa Gupta, Marcello Federico, Patrik Lamn bert, and Rafael Banchs 2006 Morpho-Syntactic Information for Automatic Error Analysis of Statistical Machine Translation Output...

Ngày tải lên: 16/03/2014, 20:20

6 453 0
Lab 3.1.5 Configuring a Serial Interface

Lab 3.1.5 Configuring a Serial Interface

... about Serial interface on BHM a Enter the command show interface serial on BHM Refer to interface chart BHM#show interface serial This will show the details of interface serial b List at least three ... GAD a Enter the command show interface serial on GAD Refer to interface chart GAD#show interface serial This will show the details of interface serial b List at least three details discovered by ... Configure serial interface Serial From the configure terminal mode, configure serial interface Serial on Router BHM Refer to interface chart BHM(config) #interface serial BHM(config-if)#ip address...

Ngày tải lên: 05/11/2013, 12:15

5 342 0
Tài liệu Lab 3.1.5 Configuring a Serial Interface pptx

Tài liệu Lab 3.1.5 Configuring a Serial Interface pptx

... passwords lab Step Configure serial interface Serial From the configure terminal mode, configure serial interface Serial on Router GAD Refer to interface chart GAD(config) #interface serial GAD(config-if)#ip ... about Serial interface on BHM a Enter the command show interface serial on BHM Refer to interface chart BHM#show interface serial This will show the details of interface serial b List at least following ... configuration is not saved The router uses the startup configuration when the router is started Step Display information about Serial interface on GAD a Enter the command show interface serial on GAD...

Ngày tải lên: 11/12/2013, 13:15

5 536 0
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface doc

Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface doc

... Paris interface as listed Configure the Paris router serial interface as follows: Paris(config) #interface serial Paris(config-if)#ip address 192.168.15.2 255.255.255.0 Paris(config-if)#clockrate ... interface serial (refer to interface chart) on Paris Paris#show interface serial This will show the details of interface serial Answer the following questions: a Serial is _, line protocol ... running-config startup-config Paris#copy running-config startup-config Step Enter the command show interface serial (refer to interface chart) on London London#show interface serial 2-6 CCNA 4: WAN Technologies...

Ngày tải lên: 11/12/2013, 13:15

6 369 0
Tài liệu Troubleshooting a Serial Interface doc

Tài liệu Troubleshooting a Serial Interface doc

... Paris interface as listed Configure the Paris router serial interface as follows: Paris(config) #interface serial Paris(config-if)#ip address 192.168.15.2 255.255.255.0 Paris(config-if)#clockrate ... interface serial (refer to interface chart) on Paris Paris#show interface serial This will show the details of interface serial Answer the following questions: a Serial is _, line protocol ... running-config startup-config Paris#copy running-config startup-config Step Enter the command show interface serial (refer to interface chart) on London London#show interface serial 2-6 CCNA 4: WAN Technologies...

Ngày tải lên: 11/12/2013, 15:15

6 276 0
Tài liệu Lab 3.1.5 Configuring a Serial Interface ppt

Tài liệu Lab 3.1.5 Configuring a Serial Interface ppt

... passwords lab Step Configure serial interface Serial From the configure terminal mode, configure serial interface Serial on Router GAD Refer to interface chart GAD(config) #interface serial GAD(config-if)#ip ... about Serial interface on BHM a Enter the command show interface serial on BHM Refer to interface chart BHM#show interface serial This will show the details of interface serial b List at least following ... configuration is not saved The router uses the startup configuration when the router is started Step Display information about Serial interface on GAD a Enter the command show interface serial on GAD...

Ngày tải lên: 18/01/2014, 04:20

5 433 0
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface pdf

Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface pdf

... Paris interface as listed Configure the Paris router serial interface as follows: Paris(config) #interface serial Paris(config-if)#ip address 192.168.15.2 255.255.255.0 Paris(config-if)#clockrate ... interface serial (refer to interface chart) on Paris Paris#show interface serial This will show the details of interface serial Answer the following questions: a Serial is _, line protocol ... running-config startup-config Paris#copy running-config startup-config Step Enter the command show interface serial (refer to interface chart) on London London#show interface serial 2-6 CCNA 4: WAN Technologies...

Ngày tải lên: 24/01/2014, 19:20

6 324 0
Tài liệu Báo cáo khoa học: "An ERP-based Brain-Computer Interface for text entry using Rapid Serial Visual Presentation and Language Modeling" ppt

Tài liệu Báo cáo khoa học: "An ERP-based Brain-Computer Interface for text entry using Rapid Serial Visual Presentation and Language Modeling" ppt

... of the trial and distractor responses at channel Cz on a single-trial basis, rather than averaged over all trials The signals acquired from each EEG channel are incorporated and classified to ... high-dimensional data, singularities of these matrices are problematic RDA applies regularization and shrinkage procedures to the class covariance matrix 40 Figure 4: Single-trial EEG data at channel ... the class covariances closer to the overall data covariance, and therefore to each other, thus making the quadratic boundary more similar to a linear boundary Shrinkage is applied as ˆ ˆ ˆ Σc...

Ngày tải lên: 20/02/2014, 05:20

6 551 0
AN1157   a serial bootloader for PIC24F devices

AN1157 a serial bootloader for PIC24F devices

... data and are not included in the checksum COMMANDS The data field for each packet contains one command and its associated data The commands are detailed in Appendix A: “PIC24F Serial Bootloader ... data field as a control character Within the data field, the bootloader will always accept the byte following a as data, and will always send a before any of the three control characters ... in Appendix A: “PIC24F Serial Bootloader Command Summary” The commands allow for read, write and erase operations on all types of nonvolatile memory: program Flash, data EEPROM and Configuration...

Ngày tải lên: 11/01/2016, 16:47

26 533 0
Serial Interface (SCI)

Serial Interface (SCI)

... (Universal Serial Bus) ports, used to connect PCs and peripherals, as well as data communication using Ethernet or telephone lines Figure 11.2: Serial Data Formats http://resource.renesas.com Page ... characteristics of serial data input/output compared with that of parallel data? Enter an appropriate word in parentheses Answer It takes (longer) time for inputting/outputting the same bit count of data It ... repeatedly It is assumed that SCI channel is initialized for 8-bit data, one stop bit, no parity, no interrupt, and a transfer speed of 9600 bps No error check is made on received data As a character...

Ngày tải lên: 29/09/2013, 11:20

18 289 0
Serial Interface to PIC

Serial Interface to PIC

... size and requires no external capacitors The applications developed in this chapter resorts to MAX-232 for achieving compatibility Online tutorials for indepth information regarding the RS-232 and ... inherent calibration facilitates easy interfacing to the outside world As shown in Fig 4.5 Receiving sensor data on the HyperTerminal 76 Serial Interface to PIC Fig 4.5 only a unity gain amplifer ... Displaying Data on HyperTerminal 73 A shortcut to the configuration file can be created and placed on the desktop for easy reference HyperTerminal setup procedure is described in many technical manuals...

Ngày tải lên: 03/10/2013, 01:20

10 271 0
Tài liệu Báo cáo khoa học: "A text-based search interface for Multimedia Dialectics" ppt

Tài liệu Báo cáo khoa học: "A text-based search interface for Multimedia Dialectics" ppt

... cross-lingual information resources for automatically expanding and generalising the data (semantic relations) one can mine from the corpus Figure 1: The COSMOROE cross-media relations For annotating a ... offsets Also, the user may watch the video clips of the modalities that participate in the relation (e.g a particular gesture) and/or a static image (keyframe) of a participating image region (e.g a ... Further details on the hit, i.e information an advanced user would get, are available following the advanceinformation link The use of semantic relations in multimedia data, in this case, is hidden...

Ngày tải lên: 22/02/2014, 02:20

4 294 0
Báo cáo khoa học: "A spoken dialogue interface for TV operations based on data collected by using WOZ method" pptx

Báo cáo khoa học: "A spoken dialogue interface for TV operations based on data collected by using WOZ method" pptx

... called by its name, the IFR opens its eyes and enters a state that can perform various operations For example, the IFR can assist the user search for a program, can present information about any ... IFR has been given the appearance of a stuffed animal One advantage of this IFR is that it can be directly touched and manipulated to create a feeling of warmth and closeness On hearing a greeting ... operations, the words such as program titles, names of broadcast stations, names of entertainers and etc have a high probability of occurring and are also Figure 3: Interface robot and an operation...

Ngày tải lên: 31/03/2014, 03:20

4 271 0
Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx

Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx

... TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG ... GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA TTCTCGCCAACTTACAAGGCCTTTCT CACCAGCACCATGCAACTTTTT ORF located in ... genome amplification and fragment amplification Primers WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC...

Ngày tải lên: 18/06/2014, 18:20

7 404 0
w