the valuation of a single asset

Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

... adsorbed by H The charge around the H atom at the Si adatom removes toward the adsorbed Ag atom and forms a covalent-like Ag-H bond Due to the charge transfer from the H to the Si adatom on the ... calculating the total energy of the system including full relaxation of all Si atoms and H atoms (except for the bottom hydrogenated Si atoms) and the Ag adatom The adsorption energies (Ead) are ... influences of H on the Ag adsorption at a Si(111)-7 surface, we first calculate the adsorption energies of Ag atom at the high coordination sites on the clear and 19H-Si(111)-7 surfaces, because all the...

Ngày tải lên: 22/06/2014, 00:20

6 368 0
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx

Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx

... determined numerical values of the ratio a/ b, and is the theoretical numerical value of ratio a/ b for a mixture of aromatic amino acids (Tyr and Trp), containing the same molar ratio as the protein ... not mark any as poor or inappropriate Another structural analysis, obtained by the VERIFY3D program [61], gave an average value of 0.21, which is greater than zero, the quality value indicated ... and therefore a positive value indicates better than average and their maximum values are around The values for all these parameters obtained for the PsbQ model were quite good and the programs...

Ngày tải lên: 21/02/2014, 00:20

12 550 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

... solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band gap for SnS NCs compared with the bulk material can be explained by quantum confinement ... decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates at relatively low temperatures Indeed, the heating of the reaction mixture without amines at elevated temperature did not ... [30] a kðhv À EgÞn=2 hv ð1Þ In Eq 1, k and n are constants and Eg is the band gap energy of the bulk semiconductor The n value is for indirect-gap materials Values of the optical band gap for the...

Ngày tải lên: 22/06/2014, 22:20

5 365 0
Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt

Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt

... solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band gap for SnS NCs compared with the bulk material can be explained by quantum confinement ... decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates at relatively low temperatures Indeed, the heating of the reaction mixture without amines at elevated temperature did not ... [30] a kðhv À EgÞn=2 hv ð1Þ In Eq 1, k and n are constants and Eg is the band gap energy of the bulk semiconductor The n value is for indirect-gap materials Values of the optical band gap for the...

Ngày tải lên: 22/06/2014, 22:20

5 276 0
The Integration of Functions of a Single Variable, by G. H. Hardy pptx

The Integration of Functions of a Single Variable, by G. H. Hardy pptx

... paragraphs that we can always find the rational part of the integral, and can find the complete integral if we can find the roots of Q(x) = The question is naturally suggested as to the maximum of ... constants which are the roots of an algebraical equation are treated as known then the form of the integral can always be determined completely But as the roots of such equations are not in general ... sum of an algebraical function and of a finite number of constant multiples of logarithms of algebraical functions All algebraical functions which occur in the integral are rational functions of...

Ngày tải lên: 28/06/2014, 19:20

86 262 1
Báo cáo khoa học: " Persistent occurrence of a single Streptococcus equi subsp. zooepidemicus clone in the pig and monkey population inIndonesia" ppsx

Báo cáo khoa học: " Persistent occurrence of a single Streptococcus equi subsp. zooepidemicus clone in the pig and monkey population inIndonesia" ppsx

... Isrina Oktavia Salasia et al reactions and with a commercial grouping kit (Slidex Strepto-kit bioMerieux, Nürtingen, Germany) The growth pattern of the bacteria in fluid media and the morphology of ... and with compact colonies in soft agar The growth properties of these three bacteria obtained from the original outbreak had already been described [15] According to studies of Abdulmawjood and ... (Biolabs, Schwalbach, Germany) [1] The preparation and SmaI digestion of the chromosomal DNA for macrorestriction analysis of the isolates by pulsed-field gel electrophoresis was performed as described...

Ngày tải lên: 07/08/2014, 18:20

3 314 0
Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt

Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt

... Nishimura G, Kawabata H, Yokoyama H, Yoshida A, Tominaga S, Nagano J, Shimizu A, Wakana S, Gondo Y, Noda T, Shiroishi T, Ikegawa S: A novel dominant-negative mutation in Gdf5 generated by ENU mutagenesis ... unrelated families Am J Med Genet A 2003, 11 7A: 136-142 20 Miyamoto Y, Mabuchi A, Shi D, Kubo T, Takatori Y, Saito S, Fujioka M, Sudo A, Uchida A, Yamamoto S, Ozaki K, Takigawa M, Tanaka T, Nakamura ... leads to a developmental deficiency of the acetabulum and proximal femoral element, especially the femoral head As mentioned above, the absence of GDF5 can cause developmental failure of intra-articular...

Ngày tải lên: 09/08/2014, 13:22

5 444 0
Báo cáo y học: " Carinal surgery: experience of a single center and review of the current literature" potx

Báo cáo y học: " Carinal surgery: experience of a single center and review of the current literature" potx

... optimal anaesthetic and surgical strategies are to be taken into consideration Anaesthetic strategies Multidisciplinary team approach and close collaboration with the anaesthetist, is required Page ... lobectomy years ago CP: carinal plasty with reinplantation of the right main bronchus to the trachea for Tracheal Sarcoma (TS) or carcinoid tumor A: Alive D:Dead The postoperative mortality was 12.5% ... sequence alignment and drafted the manuscript and VY participated in its design and coordination The authors read and approved the manuscript Author Details 1Cardiothoracic Department, Royal Victoria...

Ngày tải lên: 10/08/2014, 09:22

7 311 0
Báo cáo y học: "The role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters. Results of a 20-year single centre retrospective analysis" pptx

Báo cáo y học: "The role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters. Results of a 20-year single centre retrospective analysis" pptx

... multivariate analysis of cancer-related survival in the total populationa Risk factor Multivariate analysisc Univariate analysis p valueb R-status Masaoka stagingd Presence of a pseudocapsula WHOd classificatione ... Okumura M, Ohta M, Tateyama H, Nakagawa K, Matsumura A, Maeda H, Tada H, Eimoto T, Matsuda H, Masaoka A: The World Health Organization histologic classification system reflects the oncologic behavior ... case each in patients with an incomplete encapsulated thymoma or a missing capsula Neo-Adjuvant and Adjuvant Therapy As far as a neoadjuvant or adjuvant therapy is concerned two major aspects...

Ngày tải lên: 10/08/2014, 10:20

10 355 0
Báo cáo khoa học: " Risk Factors for High Endoparasitic Burden and the Efficiency of a Single Anthelmintic Treatment of Danish Horses" doc

Báo cáo khoa học: " Risk Factors for High Endoparasitic Burden and the Efficiency of a Single Anthelmintic Treatment of Danish Horses" doc

... the aim of validating the questionnaire (Lendal et al 1998) Data analysis Initially bivariate analyses were performed, and variables having p-values below 0.15 were included in the multivariate ... estimation The confidence interval of the estimates was based on Wald’s statistics Efficiency of a single anthelmintic treatment The bivariate and the multivariate regression analyses were based ... factors associated with high endoparasite burden and 2) to evaluate the efficiency of a single anthelmintic treatment of Danish horses Materials and methods In 1994 veterinarians from "The Danish...

Ngày tải lên: 12/08/2014, 15:20

8 294 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... for another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all of the necessary data is available, may use a separate thread to copy that data ... copied) data in a message • Data manager backs its own data Deadlock may occur if a data manager becomes blocked in a page fault waiting for data which it provides Fortunately, there are several techniques...

Ngày tải lên: 12/09/2012, 15:05

23 1,3K 1
List the components of a radio system

List the components of a radio system

... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of ... Divides the transmission time into several slots – Each user is assigned the entire frequency for the transmission • For a fraction of time on a fixed, rotating basis – Advantages • Uses the bandwidth...

Ngày tải lên: 13/09/2012, 10:52

30 922 0
Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf

Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf

... languages belonged to a third, Nilo-Saharan family, which may have originated in the broad Saharan region at least as early as Afroasiatic Nilo-Saharan may be distantly related to the fourth family, ... taken Carthage a decade later, and extended their power across the region sub-saharan africa Whether Carthage transmitted metalworking to sub-Saharan Africa is one of the mysteries of African ... religions, and alphabetic literacy that sub-Saharan Africa partially shared with the Eurasian core Partial isolation meant that cultural phenomena took distinctively African forms Partial integration...

Ngày tải lên: 21/09/2012, 10:39

386 1,2K 4
Guest the meaning of a word

Guest the meaning of a word

... (not, reversal) ex- (out of, former) pre- (before) re- (again, restore) un- (do the opposite of) ad- (to, toward) com-, con-, co- (with, together) en-, em- (in, into, to cover or contain) in- (into, ... (with, together) en-, em- (in, into, to cover or contain) in- (into, not) pro- (in favor of, before) sub- (under, beneath) ...

Ngày tải lên: 02/10/2012, 12:07

2 874 1
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11] This is a quasi-experimental...

Ngày tải lên: 25/10/2012, 11:00

6 693 0
The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company

The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company

... engages mainly in the industry of household appliances, as well as the domains of real estate and logistics The group is also one of the largest manufacturing and exportation bases of electric appliances ... Generally, if possible, it is wise to adopt the internal law as governing law to the contract On the other hand, the parties can agree to adopt a certain world law regarding international trade ... days after of the buyer’s advice ARTICLE 8: ARBITRATION During the performance of the contract, if any dispute arises, the parties shall discuss to find solution in an amicable way If the parties...

Ngày tải lên: 18/04/2013, 08:57

41 617 0
Experimental study on the performance of a prism-shaped integrated collector-storage solar water heater

Experimental study on the performance of a prism-shaped integrated collector-storage solar water heater

... water ascends to the top of the tank It is originated from the fact that, after gaining heat from the solar radiation, the tank wall heats a thin vertical layer of water along the tank wall Part ... function of the density, specific heat capacity and the initial and massweighted average temperatures of water; with all the values, apart from the mass-weighted average temperature, are the same ... solar radiation and average temperature of the present experimental study and the theoretical results of [1] in January Figure 12 The time variation of solar radiation and stored energy of the...

Ngày tải lên: 05/09/2013, 15:28

12 521 1
w