... Hydrilla verticillata Myriophyllum spicatum Blyxa aubertii Eichhornia crassipes Aquatic plant Wolfia arrhiga live drift Pistia stratiotes Salvinia spp Typha spp Aquatic plant Scirpus spp live float ... growing capability Ludwigia in waste water - Stage III: Analyse data and conclude the waste treatment capability of Ludwigia 4.2.2 Material – Means of study + Ludwigia + Brass basin for dispose ... Since then we can compare with different concentration, analyse data of study and conclude about the waste treatment of Ludwigia - Experiment is disposed such as: Each brass basin has 10l (waste
Ngày tải lên: 15/01/2016, 16:17
... 10279 U.S .A All characters in this book have no existence outside the imagination of the author and have no relation whatsoever to anyone bearing the same name or names They are not even distantly ... his brow as he headed for his car, wishing he'd had the nerve to ask Annie for his change His shirt was damp and sticky before he reached for the door handle Merle saw the sun radiate off the windshield ... S .A. , used under license Trademarks indicated with ® are registered in the United States Patent and Trademark Office, the Canadian Trade Marks Office and in other countries Visit Silhouette at
Ngày tải lên: 25/02/2019, 16:36
Dcsbis (PA2771) from pseudomonas aeruginosa is a highly active diguanylate cyclase with unique activity regulation
... Binding of the potential regulatory ligand to the GAF domain may induce conformational change in the GAF domain, and thus break the GAF dimerization and lead to the release of the blockage of the I-site ... it was speculated that the GAF domain promotes the DGC activity of the GGDEF domain This increased activity may result from the dimerization via the GAF domain The unknown ligand might play a role ... proteins, the DGC activity has been shown to largely decrease after the removal of the GAF domain This finding suggests that the DGC activity of Dcsbis is modulated by the GAF domain Although the GAF
Ngày tải lên: 24/11/2022, 17:53
opening the conformation is a master switch for the dual localization and phosphatase activity of pten
... with the plasma membrane due to a higher affinity for the membrane22 To dissociate PTENA4 and ePTEN from the plasma membrane, we introduced a cancer-associated mutation, L42R (lysine changed to arginine ... neither K1 3A nor K13R decreased association of PTENA4 with the plasma membrane (Fig. 3B) These data suggest that a positive residue at amino acid position 13 is critical for the enzymatic activity ... HEK293T cells by co-transfecting plasmids expressing shRNA1 (5ʹ-GCTGAACTATACGGTTCAAAT-3ʹ) and shRNA2 (5ʹ-CGGTTGGAGAATGTAGCAATA-3ʹ) After 24 h of transfection, transfectants were selected with
Ngày tải lên: 04/12/2022, 16:02
The past is a foreign country: amnesia and marketing theory
... was influential and gradually gained support in the academy It was also of interest to the Nazis who via their ‘abuse of genetics’ tainted the image of this approach This combined with the rise ... thought, we may well ask what causes amnesia It may be the result of the fact that marketing history is rarely taught, especially at the doctoral level (Tadajewski and Jones, 2008), leading to the types ... consumer behaviour (e.g Saad, 2004; Saad and Gill, 2000, 2003; Saad and Peng, 2006; see also Hirschman, 2008) Historically this is a problematic area Biological and genetic research have had a ‘difficult’
Ngày tải lên: 02/01/2023, 13:57
Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx
... plasminogen activator Nature 377, 340–344 Hirata A, Yoshida S, Inoue N, Matsumoto-Miyai K, Ninomiya A, Taniguchi M, Matsuyama T, Kato K, Iizasa H, Kataoka Y, Yoshida N & Shiosaka S (2001) Abnormalities ... contains 17 amino acids of the proenzyme fragment and 268 amino acids of the mature enzyme, so the molecular mass is calculated to be about 31 kDa This discrepancy may be attributable to posttranslational ... (forward, CCCA AGCTTACCATGAATCTACTCCTGAT; reverse, GTTG GTACCTTGTCATCATCATCAAAGG), and inserted into the pcDNA3 vector (Invitrogen) at the HindIII and KpnI sites to produce pTSd The cDNA fragment
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: The highly conserved extracellular peptide, DSYG(893–896), is a critical structure for sodium pump function docx
... type 5¢-GTGGAGGACAGCTATGGGCAGCAG-3¢ Asp893fiArg 5¢-GTGGAGCGCAGCTATGGGCAGCAG-3¢ Asp893fiGlu 5¢-GTGGAGGAGAGCTATGGGCAGCAG-3¢ Asp893fiAla 5¢-GTGGAGGCCAGCTATGGGCAGCAG-3¢ Ser894fiAsp 5¢-GTGGAGGACGACTATGGGCAGCAG-3¢ Ser894fiIle 5¢-GTGGAGGACATCTATGGGCAGCAG-3 Gly896fiArg 5¢-GTGGAGGACAGCTATAGGCAGCAG-3¢ Gly896fiIle 5¢-GTGGAGGACAGCTATATCCAGCAG-3¢ Second ... 5¢-GTGGAGGACAGCTATAGGCAGCAG-3¢ Gly896fiIle 5¢-GTGGAGGACAGCTATATCCAGCAG-3¢ Second primer for all of the above 5¢-GTCATTAATCCAACGGTCATCCCA-3¢ a Primers used for mutations by PCR and the QuikChange TM Site-Directed Mutagenesis Kit Wild ... replacing the 26 amino acids of the r at a3 subunit (Asn886)Ala911) with the corresponding region from either the gastric (Gln905-Val930) or the distal (Asn908-Ala933) colon H + /K + -ATPase of the
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx
... of this reac- tion, along with a detailed analysis of the spectroscopic properties of the product of NADP + oxidation. Results and Discussion NADPO isolation, quantitation, and spectral characterization In ... 2 shows the typical analysis of aliquots sampled at increasing incubation times from a reaction mixture where FprA was incubated with NADP + in air. As Fig. 1. Hypothetical mechanism of the reductive ... mammalian adrenodoxin reductase also catalyzed this unusual reaction. Thus, the 3-carboxamide-4-pyridone adenine dinucleotide phosphate formation reac- tion seems to be a peculiar feature of the
Ngày tải lên: 16/03/2014, 11:20
The RAND Corporation is a nonprofit research organization providing objective analysis and effective solutions that address the challenges facing the public and private sectors around the world. potx
... physical and mental health formalized by the state’s Medicaid waiver by requiring that state laws and state Medicaid contracts mandate communication and information-sharing regarding maternal ... project team in both an advisory and a participatory capacity Individual members... cultural competence, and integrated/holistic care • Families well educated about available programs and ... maternal and child health care system, will: • Expand and further engage the existing local maternal and child health care stakeholders’ learning collaborative to form a leadership collaborative
Ngày tải lên: 22/03/2014, 09:20
Reserve Recruiting and the College Market - Is a New Educational Benefit Needed doc
... We also compare the educational benefits available to reservists with those available to civilians and other military personnel While the adequacy... to attract and retain high-quality ... compare to educational benefits available to civilians and active duty veterans These comparisons are presented in Chapter 4 After synthesizing these descriptive analyses of the significance ... and his input to this research - xvii - ABBREVIATIONS Armed Forces Qualification Test AFQT Active Guard Reserve AGR Armed Services Vocational Aptitude ASVAB Battery College Assistance
Ngày tải lên: 23/03/2014, 02:20
This pdF is a sample of the trend database & Monthly Snapshot potx
... www.trendwatching.com/premium And if you have any questions, please contact Paul Backman TREND DATABASE This is a small sample aimed at illustrating the key features of our Trend Database (just one part of our ... inspiration for a new strategy, product/ service or campaign On top of that, up to 200 new examples are added each month, and all content can be easily downloaded in various formats, then tailored ... TREND DATABA SE SA MPLE trend watching com PREMIUM 1.2 TREND DATABASE » TREND DATABASE M SA E PL Keyword search the Database Filter trend examples by industry by trends, industries & time Full list
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot
... Total chemical synthesis and NMR characterization of the glycopeptide tx 5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a- D-Gal-(1fi3) -a- D-GalNAc James ... glycosylated at position Taken together, these data identified the glycan as a- D-Gal-(1fi3 )a- D-GalNAc There are several NOEs between the glycan and the glycopeptide side-chain atoms of tx 5a, which ... b-D-Gal-(1fi3) -a- D-GalNAc containing glycopeptide, and native tx 5a were simultaneously incubated and reacted with the same vial of the enzyme b-galactosidase Native tx 5a, tx 5a hydrophilic, and tx5a
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: The Promyelocytic Leukemia Zinc Finger (PLZF ) gene is a novel transcriptional target of the CCAAT-DisplacementProtein (CUX1) repressor ppt
... 5¢-tcaatgtcggatg gatgaaa-3¢ Acknowledgements We thank Dr Peter G Traber for the generous gift of the microarray data analysis that was originally performed at the Penn Microarray Facility ... (5¢-gaaaggcatcccgaacgcat-3¢); Chip2up primer (5¢-aaatgtcttgaccagccgtc-3¢) and Chip2dw primer (5¢-gaaacaaaggcctctcccag-3¢); Chip3up primer (5¢-gctttgcagt- cagaatggtc-3¢) and Chip3dw primer (5¢-ctgagcactgactac- gaaac-3¢). ... MG_U74Av2 GeneChips (Affymetrix, Santa Clara, CA, USA), followed by microarray analysis as described elsewhere [51]. Micro- array Analysis Suite 5.0 (MAS, Affymetrix) was used to quantify microarray
Ngày tải lên: 29/03/2014, 21:20
Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf
... CGTTCTTAGAAGCGGTGCATTTTCC PAF K3 5A opafK35Ase GTTTGATAACAAGGCTTGCACCAAGG pPic9Kmpaf opafK35Arev CCTTGGTGCAAGCCTTGTTATCAAAC PAF K3 8A opafK38Ase GAAGTGCACCGCTGATAATAACAAATG pPic9Kmpaf opafK38Arev CATTTGTTATTATCAGCGGTGCACTTC PAF K35,3 8A opafK35,38Ase ... CATTTGTTATTATCAGCGGTGCACTTC PAF K35,3 8A opafK35,38Ase GTTTGATAACAAGGCTTGCACCGCTG pPic9KpafK3 8A opafK35,38Arev CAGCGGTGCAAGCCTTGTTATCAAAC PAF K9,35,3 8A opafK9Ase GGAAAATGCACCGCTTCTAAGAACG pPic9KpafK35,3 8A opafK9Arev ... restrictions sites for inframe cloning into the pPic9K expression vector (forward 5¢-AG CTCGAGAAAAGAGCCAAATACACCGGAAAA TG-3¢, XhoI site underlined; reverse 5¢-CT GAATTCCTA GTCACAATCGACAGCGTTG-3¢, EcoRI
Ngày tải lên: 29/03/2014, 23:20
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... 5-ACATTGT GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3. Acknowledgement This ... [c- 32 P]-ATP. MBP was used as an artifi- cial substrate to assess the kinase activity and GST alone was used as a negative control. The top panel shows the kinase assay visualized by autoradiography and ... mutants simulating disease resistance response. Cell 77, 565–577. 26 Takahashi A, Agrawal GK, Yamazaki M, Onosato K, Miyao A, Kawasaki T, Shimamoto K & Hirochika H (2007) Rice Pti 1a negatively...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu ECTS Users’ Guide: Europe Direct is a service to help you find answers to your questions about the European Union doc
... to the learner is the same as the number of credits allocated to the component. The full number of credits is always awarded if the student achieves a passing grade; it is never adjusted according ... information), but they should ascertain that it contains all the elements and that, as far as pos- sible, the sequence is respected. More information on the European Union is available on the ... workload information• about these assessment methods that is available well in advance award of the number of ECTS credits• allocated to each educational component after the required assessment...
Ngày tải lên: 16/02/2014, 03:20
Bạn có muốn tìm thêm với từ khóa: