the biology of a changing virus

Ocean Acidification: A National Strategy to Meet the Challenges of a Changing Ocean docx

Ocean Acidification: A National Strategy to Meet the Challenges of a Changing Ocean docx

... existing data management offices and databases that could support ocean acidification observational and research data The FOARAM Act also calls for an “Ocean Acidification Information Exchange” that ... delineates ambitious priorities and goals for the National Ocean Acidification Program The FOARAM Act calls for the development of a detailed, 10-year strategic plan for the National Ocean Acidification ... contributions of calcite and aragonite, and hence of the organisms 23 Copyright © National Academy of Sciences All rights reserved Ocean Acidification: A National Strategy to Meet the Challenges of a Changing...

Ngày tải lên: 15/03/2014, 15:20

163 401 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

... hantavirus recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the ... stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed ... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of...

Ngày tải lên: 18/06/2014, 22:20

5 483 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt

báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt

... hantavirus recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the ... stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed ... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of...

Ngày tải lên: 20/06/2014, 04:20

5 430 0
báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot

báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot

... Rintahaka J, Søby S, Horan KA, Poltajainen A, Østergaard L, Paludan SR, Matikainen S: Early innate recognition of herpes simplex virus in human primary macrophages is mediated via the MDA5/MAVSdependent ... performed data analysis, and drafted the manuscript VSC participated in the performance of the in vivo viral infections and the isolation of CNS cells MM participated in the preparation of viral stocks ... laboratory [21,23,24] After incubation with a rabbit polyclonal antibody against DAI (Abcam, Cambridge, MA), RIP3 (Abcam, Cambridge, MA), STING (Abcam, Cambridge, MA) or a mouse monoclonal antibody...

Ngày tải lên: 19/06/2014, 22:20

12 529 0
half year report 1999 good half-year results with a further increase in net income the holderbank group confirms its strength and flexibility in the face of rapidly changing market conditions

half year report 1999 good half-year results with a further increase in net income the holderbank group confirms its strength and flexibility in the face of rapidly changing market conditions

... headway on cial markets, Central America and parts various projects The doubling of ca- of the Caribbean reported positive pacity at the Midlothian plant in Texas macroeconomic trends South America, ... somewhat in the second half of Group companies Apasco and Grupo 1999 and that building activity in other Incsa-PC significantly improved their markets will remain at a reasonable financial results ... region Asia Pacific the Alpine region hampering the start remained at the same level as 1998 A of the season Cement consumption is slight decline in operating profit was likely to rise further in the...

Ngày tải lên: 27/07/2014, 16:05

35 314 0
Báo cáo khoa học: "Effects of cyclosporin A treatment on the pathogenesis of avian leukosis virus subgroup J infection in broiler chickens with Marek’s disease virus exposure" ppt

Báo cáo khoa học: "Effects of cyclosporin A treatment on the pathogenesis of avian leukosis virus subgroup J infection in broiler chickens with Marek’s disease virus exposure" ppt

... seconds The melting curve analysis was done with an initial denaturation at 95oC DNA melting was accomplished with an initial temperature of 65oC for 10 seconds and a gradual temperature increase ... Mareks disease virus (MDV) by agar gel immunodiffusion test (California Animal Health Food Safety Laboratory System, University of California, 250 Yongbaek Kim et al Table Virus neutralizing antibody ... symposium pp 58-62 American Association of Avian Pathologists Reno, Nevada 1997 32 Payne, L N HPRS-103: a retrovirus strikes back The emergence of subgroup J avian leukosis virus Avian Pathol 1998,...

Ngày tải lên: 07/08/2014, 17:22

11 412 0
Báo cáo y học: " The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus" potx

Báo cáo y học: " The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus" potx

... and avoids potential cross contamination during sample preparation for post-PCR analysis Real-time RT-PCR assays have been widely utilized for early diagnosis of many other animal viral diseases ... viral RNA of all field samples was extracted by using QIAamp Viral RNA Mini Kit (Qiagen) In brief, after lysis of the specimens, the mixture was applied to a spin column as described by the manufacturer's ... sequence data from the PRRSV N protein gene The partial sequence of the N gene of PRRSV strain ch- 1a was downloaded from GenBank (accession no AY032626) and was aligned (using Clustal W program in the...

Ngày tải lên: 12/08/2014, 04:20

7 350 0
Báo cáo khoa học: " Characterization of a VHS virus genotype III isolated from rainbow trout (Oncorhychus mykiss) at a marine site on the west coast of Norway" doc

Báo cáo khoa học: " Characterization of a VHS virus genotype III isolated from rainbow trout (Oncorhychus mykiss) at a marine site on the west coast of Norway" doc

... TCT CTC T Elongation factor EL 1A- elaf CCC CTC CAG GAC GTT TAC AAA alpha EL 1A- elam1 ATC GGT GGT ATT GGA AC S salar EL 1A- elar CAC ACG GCC CAC AGG TAC A Duesund et al Virology Journal 2010, 7:19 ... CGG ACA GGG AGC ATG GTA TAG theridion Amplicon size GGT CCA GGT TGG GTC TTG AG Flavobacterium Flavo-R Flavo-probe AAA CAC TCG GTC GTG ACC Candidatus Flavo-F Pch-F Pch-probe CAA AAC TGC TAG ACT AGA ... population of rainbow trout is exposed to a population of marine VHS viruses the variant best adapted to this new host will dominate and may cause disease [3] The virus may also mutate after it has...

Ngày tải lên: 12/08/2014, 04:21

15 252 0
Báo cáo y học: "Use of a multi-virus array for the study of human viral and retroviral pathogens: gene expression studies and ChIP-chip analysis" pot

Báo cáo y học: "Use of a multi-virus array for the study of human viral and retroviral pathogens: gene expression studies and ChIP-chip analysis" pot

... treated the Cy3 and adjusted Cy5 intensities as technical replicates and calculated the mean of these values The ratio of this mean on the average of the intensity across the array set was then ... Genomic organization of arrayed viruses Genomic organization of arrayed viruses Locations and direction of transcription of each open reading frame of the arrayed viral genomes are shown Red arrows ... array, the geometric mean of the measured fluorescence intensities was calculated for both the experimental and control and the ratio of these was used as a scaling factor to adjust the values of all...

Ngày tải lên: 13/08/2014, 13:20

15 376 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... for another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all of the necessary data is available, may use a separate thread to copy that data ... that must be prevented For example, a data manager may wish to temporarily allow read-only access to cached data The locking on a page may later be changed as deemed necessary by the data manager...

Ngày tải lên: 12/09/2012, 15:05

23 1,3K 1
List the components of a radio system

List the components of a radio system

... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of ... Divides the transmission time into several slots – Each user is assigned the entire frequency for the transmission • For a fraction of time on a fixed, rotating basis – Advantages • Uses the bandwidth...

Ngày tải lên: 13/09/2012, 10:52

30 922 0
Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf

Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf

... languages belonged to a third, Nilo-Saharan family, which may have originated in the broad Saharan region at least as early as Afroasiatic Nilo-Saharan may be distantly related to the fourth family, ... taken Carthage a decade later, and extended their power across the region sub-saharan africa Whether Carthage transmitted metalworking to sub-Saharan Africa is one of the mysteries of African ... religions, and alphabetic literacy that sub-Saharan Africa partially shared with the Eurasian core Partial isolation meant that cultural phenomena took distinctively African forms Partial integration...

Ngày tải lên: 21/09/2012, 10:39

386 1,2K 4
Guest the meaning of a word

Guest the meaning of a word

... (not, reversal) ex- (out of, former) pre- (before) re- (again, restore) un- (do the opposite of) ad- (to, toward) com-, con-, co- (with, together) en-, em- (in, into, to cover or contain) in- (into, ... (with, together) en-, em- (in, into, to cover or contain) in- (into, not) pro- (in favor of, before) sub- (under, beneath) ...

Ngày tải lên: 02/10/2012, 12:07

2 874 1
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11] This is a quasi-experimental...

Ngày tải lên: 25/10/2012, 11:00

6 693 0
The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company

The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company

... engages mainly in the industry of household appliances, as well as the domains of real estate and logistics The group is also one of the largest manufacturing and exportation bases of electric appliances ... Generally, if possible, it is wise to adopt the internal law as governing law to the contract On the other hand, the parties can agree to adopt a certain world law regarding international trade ... days after of the buyer’s advice ARTICLE 8: ARBITRATION During the performance of the contract, if any dispute arises, the parties shall discuss to find solution in an amicable way If the parties...

Ngày tải lên: 18/04/2013, 08:57

41 617 0
Experimental study on the performance of a prism-shaped integrated collector-storage solar water heater

Experimental study on the performance of a prism-shaped integrated collector-storage solar water heater

... water ascends to the top of the tank It is originated from the fact that, after gaining heat from the solar radiation, the tank wall heats a thin vertical layer of water along the tank wall Part ... function of the density, specific heat capacity and the initial and massweighted average temperatures of water; with all the values, apart from the mass-weighted average temperature, are the same ... solar radiation and average temperature of the present experimental study and the theoretical results of [1] in January Figure 12 The time variation of solar radiation and stored energy of the...

Ngày tải lên: 05/09/2013, 15:28

12 521 1
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model

Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model

... populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income populations towards ... behavioral and attitudinal aspects of individuals An in-depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in shaping up a personality ... expectations The academia in Pakistan may facilitate the MFIs in producing relevant research work in understanding the broader social paradigms of borrowers, which may actually lead to the success...

Ngày tải lên: 06/09/2013, 05:48

23 553 0
Tài liệu The message of a master - By John McDonald pdf

Tài liệu The message of a master - By John McDonald pdf

... the great masses of humanity are using the Law destructively, or partially so, and the scales are balanced against them Here and there, among the masses, we find an occasional outstanding figure ... inferior creatures as the beasts of the field, the birds of the air and the fish of the sea are bountifully supplied For any man, no matter what his station in life, to take the stand that it is the ... we know what we are talking about when we speak of the chaos of thoughts in the air http://www.RetrieveALover.com Page 33 The Message of a Master On the other hand, the man who has a set definite...

Ngày tải lên: 15/12/2013, 06:15

50 862 0
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc

Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc

... and data warehouses been able to manage a great deal of data The challenge is to capture and measure soft and qualitative information For example, in the book The Experience Economy (1999), authors ... mirrors the myriads of interactions taking place in a company and the value created in each of them The problem is not the amount of relationships since firms have the help of sophisticated information ... Skandia Navigator (Edvinsson and Malone, 1997) Value Chain Scoreboard (Lev, 2002) Description of measure Sets of human capital indicators are collected and bench-marked against a database Similar...

Ngày tải lên: 20/12/2013, 17:15

15 797 0
w