table a 10 exslt sets module functions

Bài 15- Listening (T.A 10 NC)

Bài 15- Listening (T.A 10 NC)

... football and basketball F -> two popular sports are football and baseball True or false repetition drill: 1.Singapore has 50 states Canada has the population of only 31 Million Canada is the second ... Speaker Country A Singapore B Canada C The United States 1.The country has a lot of … -> The country is a F diamonds diamond-shaped island Speaker A: 2.The country is in South Asia -> Southeast ... Answer the following questions: 1.Find the names of the countries nearest to the North Pole -> They are Canada, the USA ( Alaska), Russia, Iceland, Norway, Finland, Denmark, and Sweden...

Ngày tải lên: 24/06/2013, 01:28

10 346 0
DE OLYMPIC 2004 HÓA 10+ ĐÁP ÁN

DE OLYMPIC 2004 HÓA 10+ ĐÁP ÁN

... O C2H5 H Ag2SO4 2Ag+ + SO42T1 = 1,5 .10- 5 SrSO4 Sr2+ + SO42T2 = 2,8 .10- 7 T1 = [Ag+]2 [SO42-] T2 = [Sr2+] [SO42-] 1,5 .10 −5 [Ag+]2 => = 2,8 .10 −7 = 53,5714 [Sr2+] Coi [SO42-] = [SO42-] Ag2SO4 phân ... xanh NaOH, Na2CO3 (I) - mẫu làm quỳ h a đỏ: KHSO4 NH4Al(SO4)2 (II) - mẫu không làm quỳ đổi màu làBaCl2 + Cho BaCl2 vào (I) nhận Na2CO3 cho ↓ trắng, mẫu lại + Cho NaOH vào (II) nhận NH4Al(SO4)2 ... đem h a tan lượng hỗn hợp X vào dd HNO loãng thu dd Z (V) lít khí NO đkc Dung dòch Z v a tác dụng với dd NaOH cho kết t a màu nâu đỏ, v a tác dụng với dd BaCl2 Hãy tính (V) ĐÁP ÁN Câu 1: a Cấu...

Ngày tải lên: 04/07/2013, 01:25

5 341 0
DE OLYMPIC 2004- ĐỊA 10+ ĐÁP ÁN

DE OLYMPIC 2004- ĐỊA 10+ ĐÁP ÁN

... nặng quãng đường xa với tốc độ nhanh, ổn đònh, giá rẻ Chạy liên tục ngày đêm, Bảo đảm an toàn (1 điểm ) Hạn chế Chỉ hoạt động đường ray Đầu tư lớn: đặt đường ray, xây hệ thống nhà ga, đội ngũ cong ... tốc độ góc quay từ Tây sang Đông xích đạo Kết hướng chuyển động thẳng so với vũ trụ có dạng lệch sang phải so với hướng kinh tuyến Ở bán cầu Nam tượng xảy tương tự hướng lệch ph a trái ( điểm ... ch tắt giao thông Tai nạn giao thông gia tăng ( điểm) Phương tiện vận tải không ngừng hoàn thiện thiết bò chuyên dùng Sức vận tải từ – 30 , 40 Mẫu mã ( điểm ) Ngày chiếm ưu thế, cạnh tranh liệt...

Ngày tải lên: 04/07/2013, 01:25

6 295 0
Giáo án điện tử hóa 10  bài Lưu huỳnh

Giáo án điện tử hóa 10 bài Lưu huỳnh

... Câu 1: Dãy chất sau v a có tính oxi hoá,v a có tính khử? Sai a Cl2, O3, S Sai c Na, F2,S Ñuùng roài d Br2, O2, Ca Sai Câu 2: Đun nóng hỗn hợp gồm có 0,650 gam bột kẽm 0,224 gam bột lưu huỳnh ... nghiệm đậy kín không khí Sau phản ứng người ta thu chất ống nghiệm? a ZnS S dư c ZnS Zn dư b S, Cl2, Br2 b Chỉ có ZnS Sai Sai d ZnS, Zn S dư Sai Ñuùng roài Cho phản ứng sau: S + Fe S + 3F2 t t S ... huỳnh? Em cho biết tượng quan sát qua thí nghiệm? Sản phẩm phản ứng? Em cho biết tượng quan sát qua thí nghiệm? Sản phẩm phản ứng? Em viết phương trình phản ứng lưu huỳnh với Na, H2, Hg Xác định tính...

Ngày tải lên: 08/07/2013, 01:26

23 2,1K 8
Đề Địa 10

Đề Địa 10

... 00C Kiểu khí hậu nhiệt đới gió m a Hà Nội ( Việt Nam) mm 0C Kiểu khí hậu ôn lục đ a U-pha( Liên Bang Nga) mm ...

Ngày tải lên: 28/08/2013, 16:10

2 290 0
giáo án Hóa 10 nâng cao gọn nhất

giáo án Hóa 10 nâng cao gọn nhất

... t l phn trm s ngt ca mi ng v CT tớnh ngt trung bỡnh: aA + bB A= (a, b l phn trm ca A, B) 100 a1 A1 + a A + + a n A n 15 Tng quỏt: A = a1 + a + + a n VD1 : Tớnh NTKTB ca Cacbon Bit 13 chim 98,89% ... (nh) MA hn khớ B bao nhiờu ln d A / B = MB 7.Dung dch - /n: l hh ng nht ca dung mụi v cht tan Huyn Thng H a hc nõng cao 10 - tan ca mt cht nc (S) l s gam cht h a tan 100 g nc to thnh dd bóo h a ... dch NaOH cú gam NaOH a) Tớnh nng mol ca dd NaOH b) Phi thờm bao nhiờu ml nc vo 200 ml dung dch NaOH cú dung dch NaOH 0,1M? Gii : m NaOH n 0, = = 0, 2mol;C M = = = 0, 25M a) n NaOH = M NaOH 40...

Ngày tải lên: 02/09/2013, 19:10

72 876 7
Lý thuyết & Bài tập Hóa 10(HAY)

Lý thuyết & Bài tập Hóa 10(HAY)

... mục gổ BaCl2 chất độc CaCl2 chất chống ẩm AlCl3 chất xúc tác NHẬN BIẾT dùng Ag+ (AgNO3) để nhận biết gốc halogenua Ag+ + Cl-  → AgCl ↓ (trắng) AS (2AgCl   → 2Ag ↓+ Cl2 ↑ ) +  → AgBr ↓ (vàng ... oxit HClO Axit hipo clorơ NaClO Natri hipoclorit HClO2 Axit clorơ NaClO2 Natri clorit HClO3 Axit cloric KClO3 kali clorat HClO4 Axit pe cloric KClO4 kali pe clorat Tất hợp chất ch a oxi clo điều ... h a học, bò biến đổi từ số oxi h a ban đầu → Cl2 + NaOH  NaCl + NaClO + H2O trang 35 BÀI TẬP Lớp 10 CÂN BẰNG ION – ELECTRON Phản ứng môi trường axit mạnh ( có H+ tham giaphản ứng ) vế thừa...

Ngày tải lên: 13/09/2013, 18:10

96 1,5K 15
DE OLYMPIC 2004 HÓA 10+ DÁP ÁN.doc

DE OLYMPIC 2004 HÓA 10+ DÁP ÁN.doc

... h a xanh NaOH, Na2CO3 (I) - mẫu làm quỳ h a đỏ: KHSO4 NH4Al(SO4)2 (II) - mẫu không làm quỳ đổi màu làBaCl2 + Cho BaCl2 vào (I) nhận Na2CO3 cho ↓ trắng, mẫu lại + Cho NaOH vào (II) nhận NH4Al(SO4)2 ... O C2H5 H Ag2SO4 2Ag+ + SO42T1 = 1,5 .10- 5 SrSO4 Sr2+ + SO42T2 = 2,8 .10- 7 T1 = [Ag+]2 [SO42-] T2 = [Sr2+] [SO42-] 1,5 .10 −5 [Ag+]2 => = 2,8 .10 −7 = 53,5714 [Sr2+] Coi [SO42-] = [SO42-] Ag2SO4 phân ... đem h a tan lượng hỗn hợp X vào dd HNO loãng thu dd Z (V) lít khí NO đkc Dung dòch Z v a tác dụng với dd NaOH cho kết t a màu nâu đỏ, v a tác dụng với dd BaCl2 Hãy tính (V) ĐÁP ÁN Câu 1: a Cấu...

Ngày tải lên: 17/09/2013, 03:10

5 302 1
Kiểm tra hóa 10

Kiểm tra hóa 10

... Câu 10: Dung dòch HCl phản ứng với tất chất nhóm chất sau đây: A/ NaCl, H2O, Ca(OH)2, KOH B/ CaO, Na2CO3, Al(OH)3, S C/ Al(OH)3, Cu, S, Na2CO3 D/ Zn, CaO, Al(OH)3, Na2CO3 Câu 11: Trong oxit sau:CuO, ... Câu 11: Trong oxit sau:CuO, SO2, CaO, P2O5, FeO, Na2O, Oxit phản ứng với axit HCl là: A/ CuO, P2O5, Na2O B/ CuO, CaO,SO2 C/ SO2, FeO, Na2O, CuO D/ FeO, CuO, CaO, Na2O Câu 12: Dùng muối Iối hàng ... ch a sẵn hồ tinh bột Hiện tượng quan sát : A. dd màu xanh B dd màu vàng lục C Có kết t a màu trắng D Có kết t a màu vàng nhạt Câu 15: Dãy khí sau ( chất một) làm nhạt màu dung dịch nước brom A...

Ngày tải lên: 17/09/2013, 07:10

3 315 1
KRONE - Datasheet - HIGHBAND - 8 & 10 pr Disconnection Module

KRONE - Datasheet - HIGHBAND - 8 & 10 pr Disconnection Module

... HIGHBAND ™ & 10 Pair Disconnection Modules Application: Part Numbers: Superior high speed data and voice cross connect modules Available in and 10 pair disconnect versions These modules enable ... Disconnect Contact Approvals: ACA Compliant UL Certified Category Performance: * A maximum of equal diameter solid conductors only, of up to 0.5 conductor diameter can be terminated per slot Only ... Switching Modules HIGHBAND 16 6468 080-00 HIGHBAND 20 6468 081-00 Also available: These modules can be either patched, jumpered and used in a patch...

Ngày tải lên: 16/10/2013, 05:15

2 621 0
A LIST OF SOME PR FUNCTIONS

A LIST OF SOME PR FUNCTIONS

... enter the data in and analyze if you have access to SPSS If you not have access to SPSS, the data can also be converted to other data analysis programs by your campus research department ... It is a guide, but it also helps hold you and your team accountable for assignments Also, it is easier to evaluate the impact and success of a plan that is in writing Sections for the plan might ... reach all of them Identify Tactics to Communicate to Key Audiences Communication tactics may include traditional channels, such as media (television, radio, newspapers and magazines) and Web...

Ngày tải lên: 17/10/2013, 12:15

6 366 0
Duality for sets and functions

Duality for sets and functions

... Optimization 48 / 108 Chapter Duality for sets and functions Separation of convex sets Almost all optimality conditions and duality relationships use some sort of separation or support of convex sets ... Chapter Duality for sets and functions Dual representation of convex sets Several basic geometrical objects in IRn can be described by using linear forms For example A closed hyperplane H can ... for each x ∈ S1 and p, x ≤ α for each x ∈ S2, where ε is a positive scalar, then the hyperplane H is said to strongly separate the sets S1 and S2 Notice that strong separation implies separation...

Ngày tải lên: 23/10/2013, 15:20

20 444 0
Topological properties for sets and functions

Topological properties for sets and functions

... one has A = L + a for every aA (iii) The translate of a subspace is an a ne set tvnguyen (University of Science) Convex Optimization 30 / 108 Chapter Topological properties for sets and functions ... functions Linear Subspaces Let us recall that a subspace L is a subset of IRn which satisfies the property : ∀x, y ∈ L, ∀α ∈ IR, x + y ∈ L and αx ∈ L and that two a ne sets A and B are parallel if there ... Proposition A subset A of IRn is a ne if and only if it contains every a ne combination of finitely many of its points It is immediate that the translation of an a ne set A, namely A + x with x...

Ngày tải lên: 23/10/2013, 15:20

20 356 0
ĐỀ VÀ ĐÁP ÁN KIỂM TR A ( 10-11)

ĐỀ VÀ ĐÁP ÁN KIỂM TR A ( 10-11)

... 1 B B A D C A C ...

Ngày tải lên: 31/10/2013, 17:11

2 289 0
Bài soạn TestEL 9 - A 10

Bài soạn TestEL 9 - A 10

... TO+V2( inf) They said that your father was a good footballer =>It was said that your father was a good footballer => Your father was said to be a good footballer II-Conditional sentences (Câu ... I am having a party (in / on / at / from) Sunday evening 10) I have taken a photo (in / on / at / from) Hanoi 11) I get up (in / on / at / from) am everyday 12) I was watching TV (in / on / at ... 1.The ao dai is the ( tradition/traditional/ traditionally) dress of Vietnamese women All the schools in this area ( have improve/ have to improve/ have to be improved) Have you ( ever/ never/ already)...

Ngày tải lên: 27/11/2013, 03:11

12 287 1
Building a Strategic Internal Audit Function: A 10-Step Framework potx

Building a Strategic Internal Audit Function: A 10-Step Framework potx

... Sarbanes-Oxley Act compliance, fraud investigation and business continuity planning Global Internal Audit Sourcing SarbanesOxley Act Readiness Attack and Penetration Testing Financial Risk Management ... and challenges The use of a formal Rapid-Start Program is an effective way to ensure quick results A Rapid-Start Program is a project management technique that maps various actions, audits and ... resources “ramp up” to address the full audit programme To achieve a rapid start, many companies initially look to an outside provider This can have several advantages, including advice and counsel...

Ngày tải lên: 06/03/2014, 19:20

24 518 2
Báo cáo khoa học: Plant DNA polymerase k, a DNA repair enzyme that functions in plant meristematic and meiotic tissues docx

Báo cáo khoa học: Plant DNA polymerase k, a DNA repair enzyme that functions in plant meristematic and meiotic tissues docx

... is 5¢-AGCTACCATGCCT GCACGAAGAGTGCGTATTATGCCTACACTGGA GTACCGGAGCATCGTCGTGACTGGGAAAAC-3¢ [3H]dTTP (10 lM; 10 CiÆmmol)1) and enzymes were added as indicated in the figure legends, and incubated for ... S., Kasai, N., Shimazaki, N., Takemura, M., Asahara, H., Linn, S., Yshida, S., Matsukage, A. , Koiwai, O., Sugawara, F., Yoshida, H & Sakaguchi, K (2002) A plant phytotoxin, solanapyrone A, is an ... overlap extension using the polymerase chain reaction Gene 77, 51–59 Kimura, S., Suzuki, T., Yanagawa, Y., Yamamoto, T., Nakagawa, H., Tanaka, I., Hashimoto, J & Sakaguchi, K (2002) Characterization...

Ngày tải lên: 07/03/2014, 15:20

9 492 0
BÀI tập HÓA 10

BÀI tập HÓA 10

... Nhóm Hợp chất với Oxi H a trị cao với Oxi Tổng qt h a trị cao Trần Hồng Tuấn I .A Na2O K2O II .A MgO CaO III .A Al2O3 Ga2O3 IV .A SiO2 GeO2 V .A P2O5 As2O5 VI .A SO3 SeO3 VII .A Cl2O7 Br2O7 I R2O II ... hướng tạo anion, ví dụ natri tạo cation Na+ clo tạo anion Cl-  Các ion lần lý thuyết h a Michael Faraday khoảng năm 1830, để miêu tả thành phần phân tử mà chuyển động ph a anốt hay catốt Tuy ... tạo anion) nên B Flo, Oxi, Nito Mặt khác: AA = ZA + NA = ZA (do số p = số n hạt nhân A hạt nhân B) AB = ZB + NB = ZB Các trường hợp xãy ra: F O N ZB AB = ZB 18 16 14 ZA = 40 – 3.ZB 13 16 19 AA...

Ngày tải lên: 27/03/2014, 14:37

23 565 0
Báo cáo khoa học: Crystal structure of a designed tetratricopeptide repeat module in complex with its peptide ligand pot

Báo cáo khoa học: Crystal structure of a designed tetratricopeptide repeat module in complex with its peptide ligand pot

... backbone alignment of CTPR3 (Protein Data Bank ID: 1Na0) and FEBS Journal 277 (2 010) 105 8 106 6 ª 2 010 The Authors Journal compilation ª 2 010 FEBS A L Cortajarena et al A C Structure of designed TPR module ligand ... efficient analytical calculation of the accessible surface area and their gradient for macromolecules J Comput Chem 19, 319–333 12 Kajander T, Cortajarena AL & Regan L (2006) Consensus design as a tool ... Ramachandran plot Table X-ray data collection statistics CTPR390–Hsp90 Space group Unit cell dimensions ˚ Wavelength (A) ˚ Resolution (A) Rmerge (% )a I ⁄ rI a Completeness (% )a Redundancya v2a...

Ngày tải lên: 29/03/2014, 08:20

9 330 0
Báo cáo hóa học: " Research Article A New Subclass of Analytic Functions Involving Al-Oboudi Differential Operator" docx

Báo cáo hóa học: " Research Article A New Subclass of Analytic Functions Involving Al-Oboudi Differential Operator" docx

... Integral means inequalities for fractional derivative We will make use of the following definitions of fractional derivatives by Owa , and Srivastava and Owa Definition 4.1 The fractional derivative ... defined by a generalized S˘ l˘ gean operator,” International aa Journal of Mathematics and Mathematical Sciences, vol 2004, no 27, pp 1429–1436, 2004 G S S˘ l˘ gean, “Subclasses of univalent functions, ” ... Complex Analysis—5th Romanian-Finnish seminar, aa Part (Bucharest, 1981), vol 101 3 of Lecture Notes in Mathematics, pp 362–372, Springer, Berlin, Germany, 1983 S Sumer Eker and S Owa, “New applications...

Ngày tải lên: 21/06/2014, 22:20

10 253 0
w