suggestions for teachers at nguyen sieu and other schools

Tài liệu The Little Guide To Beating Procrastination, Perfectionism and Blocks: A Manual for Artists, Activists, Entrepreneurs, Academics and Other Ambitious Dreamers docx

Tài liệu The Little Guide To Beating Procrastination, Perfectionism and Blocks: A Manual for Artists, Activists, Entrepreneurs, Academics and Other Ambitious Dreamers docx

... change. Rather, encouragement and praise for any small step taken are the way to go.  And that’s not just true for kids; it’s true for everyone at any age.  Moreover, the field of “expectations psychology” has shown us that people often  ... stage fright throughout his long career. In fact, he got so nervous before every stage  performance and film shoot that he threw up. That’s forty years of throwing up And after every episode of throwing up, he proceeded to give his performance That’s how to respond to fear: not by letting it paralyze you, and not by wasting  ... pragmatic, but people with a healthy world view recognize negativity for what it is ­ a  sign of insecurity and a disabling force ­ and flee from it. When that happens, it often  deepens the negativist’s insecurities and reinforces her tendency toward negativity and ...

Ngày tải lên: 21/02/2014, 22:20

87 610 0
NatioNal Drug Strategy 2010–2015: A framework for action on alcohol, tobacco and other drugs pdf

NatioNal Drug Strategy 2010–2015: A framework for action on alcohol, tobacco and other drugs pdf

... National Alcohol Strategy • National Tobacco Strategy • National Illicit Drugs Strategy • National Pharmaceutical Drug Misuse Strategy • National Workforce Development Strategy • National Drug Research and Data ... complementary initiatives for different population groups • Use the internet and other media to sustain and strengthen the provision of credible and accurate information about alcohol, tobacco and other drugs ... the associated consequences through targeted public information campaigns, information sharing and social marketing • Research, investigate and gather information on all aspects relating to the...

Ngày tải lên: 29/03/2014, 20:20

32 489 0
Báo cáo khoa học: "An efficient algorithm for building a distributional thesaurus (and other Sketch Engine developments)" pdf

Báo cáo khoa học: "An efficient algorithm for building a distributional thesaurus (and other Sketch Engine developments)" pdf

... MIN for BNC, OEC and Itwac and present details for some representative ones in Table For the BNC, the number of partitions that the TPMMS process was divided into was usually between ten and ... final thesaurus but they are needed during the computation A strategy for this problem is to generate, sort and sum in sequential scan That means that instead of incrementing the sim(w1 , w2 ) score ... Dekang Lin 1998 Automatic retrieval and clustering of similar words In COLING-ACL, pages 768–774 Deepak Ravichandran, Patrick Pantel, and Eduard H Hovy 2005 Randomized algorithms and nlp: Using locality...

Ngày tải lên: 31/03/2014, 01:20

4 346 0
KETTLEBELL TRAINING FOR ATHLETES DEVELOP EXPLOSIVE POWER AND STRENGTH FOR MARTIAL ARTS, FOOTBALL, BASKETBALL, AND OTHER SPORTS pdf

KETTLEBELL TRAINING FOR ATHLETES DEVELOP EXPLOSIVE POWER AND STRENGTH FOR MARTIAL ARTS, FOOTBALL, BASKETBALL, AND OTHER SPORTS pdf

... worked for me That is the beauty of kettlebells They are so versatile that you can few things that are absolutely wrong There only are techniques that are more appropriate than others for a given ... Repeat with your opposite hand One-Hand Swing The positioning for the one-hand swing is the same as for the two-hand swing, with two exceptions First and most obvious, the grip is with one hand ... shoulders and back of the neck and will cause premature fatigue 10 KETTLEBELL TRAINING FOR ATHLETES INTRODUCTION TO POWER MOVEMENTS WEEK T his chapter discusses the one-hand swing, single snatch,...

Ngày tải lên: 31/03/2014, 19:20

224 1,4K 1
Báo cáo sinh học: " Replicative homeostasis II: Influence of polymerase fidelity on RNA virus quasispecies biology: Implications for immune recognition, viral autoimmunity and other "virus receptor" diseases" pot

Báo cáo sinh học: " Replicative homeostasis II: Influence of polymerase fidelity on RNA virus quasispecies biology: Implications for immune recognition, viral autoimmunity and other "virus receptor" diseases" pot

... morbidity and premature mortality in man, and other animals, and greater economic loss, than any other molecule 1.2 RNA viruses and immune control Despite a depressing global epidemiology that strongly ... previously, and relates to the replicative kinetics of HCV, HIV and HBV [28] and other viruses causing persistent infection Briefly, and specifically for HCV, if immune functions are responsible for ... and in some patients [35], and some chimpanzees [36], are never detected at all An exhaustive and very careful review of the clinical and experimental data relating adaptive immune response and...

Ngày tải lên: 19/06/2014, 08:20

20 399 0
báo cáo hóa học:" Replicative homeostasis II: Influence of polymerase fidelity on RNA virus quasispecies biology: Implications for immune recognition, viral autoimmunity and other "virus receptor" diseases" doc

báo cáo hóa học:" Replicative homeostasis II: Influence of polymerase fidelity on RNA virus quasispecies biology: Implications for immune recognition, viral autoimmunity and other "virus receptor" diseases" doc

... morbidity and premature mortality in man, and other animals, and greater economic loss, than any other molecule 1.2 RNA viruses and immune control Despite a depressing global epidemiology that strongly ... previously, and relates to the replicative kinetics of HCV, HIV and HBV [28] and other viruses causing persistent infection Briefly, and specifically for HCV, if immune functions are responsible for ... and in some patients [35], and some chimpanzees [36], are never detected at all An exhaustive and very careful review of the clinical and experimental data relating adaptive immune response and...

Ngày tải lên: 20/06/2014, 04:20

20 310 0
Báo cáo toán học: "Bitableaux Bases for some Garsia-Haiman Modules and Other Related Modules" ppt

Báo cáo toán học: "Bitableaux Bases for some Garsia-Haiman Modules and Other Related Modules" ppt

... indicates that we evaluate the resulting polynomial P (∂Z , ∂W ) Q at z1 = · · · = zn = w1 = · · · = wn = It is clear that for any polynomial P ∈ [Z, W ] that < P, P > ≥ and < P, P > = if and ... shape of Qβ and Mβ is higher than the shape of U and V Setting equations (2.8) and (2.9) equal and solving for (U, V )det yields that (U, V )det can be written as a linear combination of bideterminants ... T and sh(U ) = sh(V ) per (4.5) is a basis for + [X, Y, Z, W ] Suppose [U, V ]+ ∈ BSQS,T Thus U = Cρ1 (P ) and per S,T V = Cρ2 (Q) for some standard tableaux P and Q and sequences ρ1 ∈ ΥψS and...

Ngày tải lên: 07/08/2014, 07:21

59 178 0
Báo cáo y học: "Genome-wide identification of novel expression signatures reveal distinct patterns and prevalence of binding motifs for p53, nuclear factor-κB and other signal transcription factors in head and neck squamous cell carcinoma" docx

Báo cáo y học: "Genome-wide identification of novel expression signatures reveal distinct patterns and prevalence of binding motifs for p53, nuclear factor-κB and other signal transcription factors in head and neck squamous cell carcinoma" docx

... –ATTGCTTTAGCTTGGAAATTCCGGAGCTGAAGCGGCCAGCGAGGGAGGAT-ATTGCTTTAGCTTGGAAATTCCGGAGCTGAAGCGGCCAGCGAGGGAGGAT-ATTACTTCAGTTTGGAAATTCCTAGATCGCAGGGGCCAGCGAGGCAGGAC-ATTACTTCAGTTTGGAAATTCCTGGGTCGCAGGGGCCAGCGAGGCAGGAC- IL6 -76 (p65/cRel) -62 5’ –AAATGTGGGATTTTCCCATGAGTCTCAATATTAGAGTCTCAACCCCCAAT- 3’ ... p53, NF-κB, AP-1, and STAT3; expression of cytokines and other genes; and variation in radiation and chemosensitivity [5,21-26,30-33,41-43] The p53 mutation and expression status of UM-SCC cells ... (p50), and NF-κB2 AP-1 family consisted of c-Jun, JunB, JunD, c-Fos, FosB, Fra-1, Fra-2, BATF, JDP2, and SNFT We chose matrix STAT3.01 for the STAT3 search, and matrices EGR1.01 and EGR1.02 for...

Ngày tải lên: 14/08/2014, 07:21

25 350 0
Learner autonomy as perceived by teachers and students at nguyen van linh high school  a thesis submitted in partial fulfillment of the requirements for the degree of master of arts in TESOL

Learner autonomy as perceived by teachers and students at nguyen van linh high school a thesis submitted in partial fulfillment of the requirements for the degree of master of arts in TESOL

... students and five English teachers at Nguyen Van Linh high school In this research, questionnaires for students and teachers are triangulated by interviews with learners randomly invited and all ... separation from teachers and other students In other words, learner autonomy is a term used for a cooperative learning environment rather than an isolated learning, a learning process rather ... are large class size and students’ lack of motivation to apply English Especially, these teachers emphasized that the matter came from the national examination They stated that they wanted their...

Ngày tải lên: 04/07/2017, 20:44

112 353 1
Evaluating the Reliability and Validity of an English Achievement Test for Third-year Non- major students at the University of Technology, Ho Chi Minh National University and some suggestions for chan

Evaluating the Reliability and Validity of an English Achievement Test for Third-year Non- major students at the University of Technology, Ho Chi Minh National University and some suggestions for chan

... with the other (Heaton, 1998: 5) In other words, Heaton implied that teaching and learning provide a great source of language materials for testing to make use of In turn, testing reinforces, ... reliability, N: the number of raters whose combined estimates form the final mark for the examinees, rA, B: the correlation between the raters, or the average correlation among the raters if there are more ... claimed that “A test is said to be valid if measures accurately what it is intended to measure” It is taken from the Standards for Educational and Psychological Testing (1985: 9) that “Validity...

Ngày tải lên: 07/11/2012, 15:05

38 1,9K 15
Teachers' typical difficulties in teaching vocabulary to upper secondary school students of ethnic minority and suggestions for solution

Teachers' typical difficulties in teaching vocabulary to upper secondary school students of ethnic minority and suggestions for solution

... conversations and to communicate with their parents and other members of their communities They only use Vietnamese only at schools or at public places thus, so they seem to have to learn two foreign ... words, and frequently these are precisely the words that convey the meaning of the text "Vocabulary and lexical units are at the heart of learning and communication No amount of grammatical or other ... metaphorical language use and they need to know how words collocate They also need to understand what stylistic and topical contexts words and expressions occur in II.1.3.3 Word formation In English,...

Ngày tải lên: 07/09/2013, 13:45

42 837 3
Esp at hanoi water resources university – recommendations and suggestions for the current course

Esp at hanoi water resources university – recommendations and suggestions for the current course

... Linguistic features of register in Water Resources 2.2 Material and course evaluation 2.2.1 Why course evaluation 10 2.2.2 Material and course evaluation framework 11 2.2.3 Criteria for material and course ... writing materials makes us more aware of what to look for in material written by other people – and also more sympathetic to the efforts of other material writers Tony Dudley-Evans and Maggie ... addition? For what types of learning situations are the materials suitable? For what types of learning situations are the materials unsuitable? Compare with any other materials evaluated General...

Ngày tải lên: 29/01/2014, 14:43

60 385 1
Guidance on the teaching of writing skills INSET opportunities for teachers of a subjects across the curriculum at Key Stages 2 and 3 docx

Guidance on the teaching of writing skills INSET opportunities for teachers of a subjects across the curriculum at Key Stages 2 and 3 docx

... Find data relating to attainment in the three attainment targets for Welsh/English in your school/cluster/LA for the past two years, e.g Data Exchange Wales initiative (DEWi) data, information ... from primary schools via the transition plan, gender-specific data and the national core data set information Find school data relating to learners identified for Basic Skills Quality Standards purposes ... carried out before the next session? Evaluation (at the end of the INSET period when outcomes are available) What are the benefits for teachers and, ultimately, the learners? To what extent teachers...

Ngày tải lên: 10/03/2014, 05:20

174 616 0
.Get More and Do More at Dummies.com ®Start with FREE Cheat SheetsCheat Sheets include • Checklists • Charts • Common Instructions • And Other Good Stuff!To access the Cheat Sheet created specifically for this book, go towww.dummies.com/cheatsheet/e pptx

.Get More and Do More at Dummies.com ®Start with FREE Cheat SheetsCheat Sheets include • Checklists • Charts • Common Instructions • And Other Good Stuff!To access the Cheat Sheet created specifically for this book, go towww.dummies.com/cheatsheet/e pptx

... negative correlation 81 Settling for limited correlation 83 Reaching for the elusive Efficient Frontier 84 Accusations that MPT is dead are greatly exaggerated 85 Mixing and Matching ... of time and tracked their performance moving forward In one representative study, the top 30 mutual funds for sequential five-year periods were evaluated for their performance moving forward ... Internet, where there’s a blog for anything and everything, I found a blog called ETF Deathwatch According to ETF Deathwatch, any ETF that is at least six months old that has an “Average Daily Value...

Ngày tải lên: 16/03/2014, 21:20

387 2K 0
ssessment criteria for an effective EFL presentation of English majors at Hanam Teachers Training College problems and solutions

ssessment criteria for an effective EFL presentation of English majors at Hanam Teachers Training College problems and solutions

... experts, educators, researchers and other teachers to evaluate presentation? and (4) What the assessment criteria should be used to evaluate EFL presentations of English Majors at HTTC? From ... that, measure, join, watch, she,… are the most common mistakes - Inaccurate pronunciation between long vowels and short vowels For example what and water, shot and short, good and food, etc - Little ... used by teachers at HTTC to evaluate EFL presentations of English majors? 3.2 What are the current strengths and problems of English majors at HTTC in making EFL oral presentations? 3.3 What assessment...

Ngày tải lên: 19/03/2015, 10:31

46 535 0
A study on the problem face by students in reading English for business at University of Economics and Business administration-Thai Nguyen University and some i

A study on the problem face by students in reading English for business at University of Economics and Business administration-Thai Nguyen University and some i

... can motivate and stimulate the teachers and students to teach and learn This is a good motivation for them to try more and more to master the subject Apart from that, 40% of the teachers and 15% ... the purpose of the study and to facilitate data collection and analysis, a sample of ESP teachers who are currently teaching English for Business and GE at TUEBA and another sample of 120 students ... unclear information  Speed of reaction to the utterances of others  Clear pronunciation and delivery  An awareness of appropriate language and behavior for the cultures and situations in which...

Ngày tải lên: 28/03/2015, 09:32

67 1,2K 2
An investigation into the effectiveness of using task-based method in teaching and learning reading for 11th form students at Nguyen Trai High school, HN

An investigation into the effectiveness of using task-based method in teaching and learning reading for 11th form students at Nguyen Trai High school, HN

... language teaching and its applications in teaching English at schools Therefore, I think it is essential to a research on the effect of teaching Reading for the 11th form students at my school by ... reading skill for the students That is the reason why I choose to investigate the effectiveness of using task-based method in teaching and learning Reading for 11th form students at Nguyen Trai ... methodology employed and the rationale of using qualitative and quantitative method for the achievement of the aim of the study Chapter IV, Results and Discussions, presents the results and discusses...

Ngày tải lên: 10/08/2015, 19:49

5 703 3
an evaluation of the text book new english file pre intermediate for the first year non english majored students at university of social sciences and humanities suggestions for book use and adaptat pdf

an evaluation of the text book new english file pre intermediate for the first year non english majored students at university of social sciences and humanities suggestions for book use and adaptat pdf

... materials evaluation, purposes of materials, types of materials evaluation, materials evaluators, and models for materials evaluation and criteria for materials adaptation are presented Finally, some ... of materials in language teaching and learning and present major issues of materials evaluation: definitions, purposes, and types of materials evaluation, materials evaluators, models for materials ... vocabulary and integrated skills Other teachers feel attracted by informative reading texts as well as appropriate listening recordings What attracts most students (41.66 %) most is up-to - date and...

Ngày tải lên: 25/12/2015, 17:20

84 1,3K 3
An evaluation of the effectiveness of the materials on english for tour guides for the 3rd year students of foreign languages and tourism department at sao do industrial college and suggestions for adaptation

An evaluation of the effectiveness of the materials on english for tour guides for the 3rd year students of foreign languages and tourism department at sao do industrial college and suggestions for adaptation

... evaluation, materials evaluators, source of the data, models for materials evaluation and criteria for materials evaluation 1.2.1 Reasons for Materials Evaluation There are two main reasons for ... evaluation according to the reasons for materials evaluation: preliminary evaluation, formative evaluation and summative evaluation Preliminary Evaluation: Preliminary evaluation takes place before ... literature concerning major issues in materials evaluation: reasons for materials evaluation, definitions of materials evaluation, who carries out materials evaluation, who provides data for materials...

Ngày tải lên: 03/01/2016, 18:14

58 743 0
w