specifying key fields in a join logical file

Specifying Locking Hints in a SQL Server Database

Specifying Locking Hints in a SQL Server Database

... the DataAdapter and CommandBuilder SqlDataAdapter da = new SqlDataAdapter(cmd); SqlCommandBuilder cb = new SqlCommandBuilder(da); // Fill table using the DataAdapter DataTable dt = new DataTable( ... changing data being read by a user and preventing users from reading data being changed by a user Locks are acquired and released by user actions; they are managed internally by database software ... when reading a table This allows you to read data and later update it with a guarantee that it has not changed since you last read it while other users are not blocked from reading the data Cannot...

Ngày tải lên: 17/10/2013, 20:15

5 417 0
Tài liệu Specifying Locking Hints in a SQL Server Database doc

Tài liệu Specifying Locking Hints in a SQL Server Database doc

... the DataAdapter and CommandBuilder SqlDataAdapter da = new SqlDataAdapter(cmd); SqlCommandBuilder cb = new SqlCommandBuilder(da); // Fill table using the DataAdapter DataTable dt = new DataTable( ... changing data being read by a user and preventing users from reading data being changed by a user Locks are acquired and released by user actions; they are managed internally by database software ... when reading a table This allows you to read data and later update it with a guarantee that it has not changed since you last read it while other users are not blocked from reading the data Cannot...

Ngày tải lên: 14/12/2013, 18:16

5 541 0
Tài liệu Tracking Back References in a Write-Anywhere File System pdf

Tài liệu Tracking Back References in a Write-Anywhere File System pdf

... of Immediately after maintenance 200 CPs since maintenance 400 CPs since maintenance 600 CPs since maintenance 800 CPs since maintenance No maintenance 1000 100 Immediately after maintenance 200 ... Trace Overhead during Normal Operation The I/O and time overheads for maintaining back references normalized per a block operation (adding or removing a reference) The database maintenance tool ... the database produced by our algorithm 5.1 Data Storage and Maintenance We store the From and To tables as well as the precomputed Combined table (if available) in a custom row-oriented database...

Ngày tải lên: 19/02/2014, 18:20

14 469 0
Prospects of concentrating solar power to deliver key energy services in a developing country

Prospects of concentrating solar power to deliver key energy services in a developing country

... however, that even if natural gas supplies are steady there still is a certain level of excess installed capacity available within the SING grid [11] In this case again creating (additional) interconnections ... potential in the Northern part of Chile Several CSP initiatives and activities already take place in countries such as India, Morocco, Spain, Iran, South Africa, Jordan, Egypt, and the USA, mainly in ... published in magazines and books E-mail address: chkara@epu.ntua.gr Charalampos Pappas is a is a Mechanical Engineer of the National Technical University of Athens (NTUA, 1999-2005) with a M.Sc in Energy...

Ngày tải lên: 05/09/2013, 14:58

12 491 0
Evaluating Variables in a Flat File

Evaluating Variables in a Flat File

... is run and the message is sent Likewise, each escape sequence \\ evaluates to a single backslash that causes the following special character to be escaped so that it is treated as plain text ... 182 CHAPTER 26 ■ EVALUATING VARIABLES IN A FLAT FILE If you no longer need this account, please let us know so we can remove it System Administration Note in particular the shell variables (ENVIRONMENT, ... processes each line of the file using the eval statement, which causes the variables to be replaced with their string values The expanded line is assigned to the variable place_holder so that it can...

Ngày tải lên: 05/10/2013, 08:51

2 273 0
Adding Swap File Space in a Linux System

Adding Swap File Space in a Linux System

... Adding a swap file To add swap space on a system, add a swap file by using the following steps: Create a file that is equal in size to the swap file that is going to be created Do this by using ... mkswap –f /root/swap.swp or type /sbin/mkswap –f /root/swap.swp To activate this swap file, use the swapon command To make this swap file inactive, use the swapoff command in place of the swapon ... entry in made in /etc/fstab Reflection This method is the quickest and easiest way to add swap space However, it does create some problems By creating this swap file on a partition that is already...

Ngày tải lên: 16/10/2013, 21:15

2 399 0
The JSP Files (Part 1) - Purple Pigs in a Fruitbasket

The JSP Files (Part 1) - Purple Pigs in a Fruitbasket

... the application server for JavaBeans and servlets, and the database server for database connectivity Additionally, you can combine JSP with JavaBeans and Java servlets to create complex Web applications ... org.apache.tomcat.core.ServletWrapper.doService(ServletWrapper.java:404) at org.apache.tomcat.core.Handler.service(Handler.java:286) at org.apache.tomcat.core.ServletWrapper.service(ServletWrapper.java:372) at org.apache.tomcat.core.ContextManager.internalService(ContextManager.java: ... references such as this one Java In A Teacup Enter John Doe Variables are the bread and butter of every programming language and JSP has them too A variable can be thought of as a programming construct...

Ngày tải lên: 19/10/2013, 02:15

16 324 0
Tài liệu Managing Files in a Printer Queue doc

Tài liệu Managing Files in a Printer Queue doc

... In the printer queue menu bar, click File and choose Pause Printing This will cause the printer queue to hold all print jobs without sending any information to the printer Minimize the printer ... Desktop as “low.txt” Step Add this document to the printer queue by choosing File > Print Open the printer queue window (it is minimized and available on the Taskbar) Is the print job listed in the ... Sometimes it is necessary to cancel print jobs while they are being held in the printer queue In the printer queue window, right-click on “medium.txt” What options are available in the context-sensitive...

Ngày tải lên: 24/01/2014, 19:20

3 284 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT ... fw, forward; rev, reverse A B Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time ... using the QuickChange kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC-3¢...

Ngày tải lên: 19/02/2014, 02:20

14 601 0
Philosophy in a New Key A Study in the Symbolism of Reason, Rite, and Art

Philosophy in a New Key A Study in the Symbolism of Reason, Rite, and Art

... interpretation of observed facts that adjusts them to a general scientific outlook, a theory that bridges what used to appear as a saltus naturae, a logical explanation displacing a shamefaced resort ... considerations are to rest Meaning has both a logical and a psychological aspect Psychologically, any item that is to have meaning must be employed as a sign or a symbol; that is to say, it must be a ... Y IN A NEW KEY not even from mathematics; it has arisen in the fields that the great advance of learning has left fallow Perhaps it holds the seed of a new intellectual harvest, to be reaped in...

Ngày tải lên: 14/03/2014, 17:25

255 565 0
Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx

Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx

... Kishida, Y., Kohora, M., Matsumoto, M., Matsuno, A. , Muraki, A. , Nakazaki, N., Shimpo, S., Sugimoto, M., Takazawa, M., Yamada, M., Yasuda, M & Tabata, S (2001) Complete genomic sequence of the filamentous ... value of this acid–base transition is estimated based on the increase of absorbance at 418 nm as pH increases Curve fitting of the fraction of the alkaline form to the calculated values using the Henderson–Hasselbalch ... examined The inset of Fig illustrates obtained titration plots It clearly indicates that the Syn HO-1 protein (10 lM) is saturated at a ratio of : hemin to protein, thereby establishing that...

Ngày tải lên: 23/03/2014, 20:22

12 459 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

... originally described as a CoA-independent acyltransferase inhibitor [16], was included as it inhibits both LPCAT and LPAAT in MonoMac cells with IC50 values of 10 lM and 30 lM, respectively (data ... level of U 1A mRNA was similar in all samples as shown in Fig 4A This indicated equal extraction efficiency and that SK&F 98625 was not a general transcription inhibitor There was a background level ... production in a similar manner, indicating that it may generally in uence monocyte in ammatory cytokine responses to LPS Our results suggest that acyltransferases play a key role in the production of in ammatory...

Ngày tải lên: 31/03/2014, 01:20

7 322 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

... increasing hydrogen ion concentration, involving a proton-catalysis by the distal (a5 8) histidine with pKa ˆ 6.2, as with the separated chains The value of ks also increased with increasing hydrogen ... isolated a chain In contrast to this, the heme pocket of the b chain still obstructs easy access of a water molecule as well as a proton, so that the b chains can keep a constant resistance against ... evidence suggests that the a1 b1 interface is much more important in maintaining normal hemoglobin stability than is the a1 b2 interface As a matter of fact, hemolytic anemia is known to result...

Ngày tải lên: 31/03/2014, 15:20

10 648 0
conditional random fields vs. hidden markov models in a biomedical

conditional random fields vs. hidden markov models in a biomedical

... specialization may be formulated as a spliting of states by means of additional features which in our case are POS tags In our HMM-based system the specialization strategy using POS information ... Molina and F Pla Shallow parsing using specialized hmms JMLR Special Issue on Machine Learning approaches to Shallow Pasing, 2002 [6] L R Rabiner A tutorial on hidden markov models and selected applications ... any word feature, which is incorporated into the model Moreover, transition feature functions may also take into account both a word and its features as, for instance, a word context A training...

Ngày tải lên: 24/04/2014, 13:21

5 551 0
Báo cáo khoa học: "Efficient wood and fiber characterization – A key factor in research and operation." pot

Báo cáo khoa học: "Efficient wood and fiber characterization – A key factor in research and operation." pot

... definitely not lead to an increase in this proportion NATURAL VARIABILITY The natural variability has to be established as a basis for judging whether or not new trees are better than existing ... experiments in the laboratory, in a pilot plant and in mills Many properties of wood and fibers are being measured at several levels of detail The arsenal of measurement techniques available today for ... hemisphere A widespread species of this family is Populus tremula, also called aspen Aspen is also a very good raw material for printing papers and an increase in the production of aspen pulpwood...

Ngày tải lên: 08/08/2014, 14:20

12 229 0
Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx

Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx

... 5’-AGGGTCTGGGCCATGGAA-3’ b actin Forward: 5’-AGGCCAACCGTGAAAAGATG-3’ 101 NM_031144 Reverse: 5’-ACCAGAGGCATACAGGGACAA-3’ activated at 95°C for 10 minutes followed by 45 cycles of denaturing at ... according to a previously published and validated grading system where = no staining, = weak staining, = moderate staining, = strong staining, = very intense staining [6,13,17] Histopathology Pathological ... Animal work and handling were complied with the National Health and Research Council (Australia) Code of Practice for Animal Care in Research and Teaching (2004) [13] RNA extractions Total RNA was...

Ngày tải lên: 09/08/2014, 08:22

8 335 0
báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx

báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx

... and animals [5] and is involved in multiple signal transduction pathways, which are fundamental for many intercellular and intracellular interactions [6,7] Calcium plays an essential role in pollen-pistil ... controls at 575 nm was used as background The final Ca2+ amounts were calculated according to the manufacturer’sprotocol and are given in μg per μl of the sample A standard curve was prepared using ... Opin Plant Biol 1998, 1:428-433 34 Bednarska E, Lenartowska M, Niekraś L: Localization of pectins and Ca2+ ions in unpollinated and pollinated wet (Petunia hybrida Hort.) and dry (Haemanthus albiflos...

Ngày tải lên: 11/08/2014, 11:21

12 529 0
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

... 10:78 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity molybdate transporter required for efficient uptake of molybdate from ... role in sulfate translocation within developing seeds Plant Physiol 2010, 154:913-926 Kataoka T, Watanabe-Takahashi A, Hayashi N, Ohnishi M, Mimura T, Buchner P, Hawkesford MJ, Yamaya T, Takahashi ... 2008, 147:897-911 Maruyama-Nakashita A, Nakamura Y, Tohge T, Saito K, Takahashi H: Arabidopsis SLIM1 is a central transcriptional regulator of plant sulfur response and metabolism Plant Cell 2006,...

Ngày tải lên: 11/08/2014, 11:21

10 427 0
Báo cáo y học: "Lactate: a key metabolite in the intercellular metabolic interplay" pptx

Báo cáo y học: "Lactate: a key metabolite in the intercellular metabolic interplay" pptx

... lactate was maintained at a higher but constant value, indicating that the liver is not mandatory for lactate clearance [20] Lactate also appears to possess some specific effects besides its role in ... new and fascinating side of brain lactate metabolism [24,25] Concerning heart metabolism and cardiovascular function, it has recently been shown that lactate improves cardiac function in a model ... redox and carbon shuttle between organs involved in the global energy metabolism Different interesting works have emphasized a role of lactate in the brain as a protective substrate not only in animal...

Ngày tải lên: 12/08/2014, 18:21

3 251 0
Báo cáo khoa học: "Pro/con clinical debate: Steroids are a key component in the treatment of SARS" pps

Báo cáo khoa học: "Pro/con clinical debate: Steroids are a key component in the treatment of SARS" pps

... regarding the use of steroids in the treatment of SARS remain unanswered, including the efficacy of this treatment, the appropriate timing of initiation of treatment, and the dose and duration ... therapy Steroid therapy causes significant adverse effects, and this remains true in patients with SARS Wang and coworkers [12] described a case of fatal aspergillosis, and recent press reports indicate ... severe varicella pneumonia the patients treated with steroids had a shorter hospital and ICU stay despite having a lower arterial oxygen tension/fractional inspired oxygen ratio on admission to...

Ngày tải lên: 12/08/2014, 20:20

3 355 0
w