... PBEF β-actin 5' Primers ATGACTTCCAAGCTGGCCGT AAGCTTTTTAGGGCCCTTTG CAAACATGATCTGGGTCATCTTCTC 3' Primers CCTCTTCAAAAACTTCTCCACACC AGGCCATGTTTTATTTGCTGACAAA GCTCGTCGTCGACAACGGCTC Size (bp) Accession ... 5'TTAGAATTCGCCACCATGCCTGCGGCAGAAGCC-3'and reverse primer, 5'-TTAGAATTCTTAATGGTGATGGTGATGATGCAAATGATGTGCTGCTTCCAGTTC-3' The regular bold letters indicate the optimized Kozac sequence The bold italic letter ... Endothelial Cell Medium-2 (Cat No CC-4176) All cells were cultured at 37 C in a humidified atmosphere of 5% CO2, 95% air Cells from each primary flask were detached with 0.05% trypsin, resuspended...
Ngày tải lên: 11/08/2014, 08:22
... primer (FW) TCCGCTGCCAGTCGTCTTCC-3 and Reverse primer (RW) GTCCTCGCGAGTCTAGGCCA – Amplification reaction was performed in 25 l of master cocktail containing 10 mM Tris (pH 9.0), 50 mM KCl, 0.01% ... tubercle bacilli were calculated11 Statistical analysis—Analysis was carried out using SPSS ver 10 for windows software (SPSS Inc., Chicago, IL, USA) Sensitivity, specificity, positive predictive ... dynamics of tubercle bacilli in circulation Moreover, such an approach could bring a new dimension in the early detection of M tuberculosis, in EPTB patients, from a readily accessible clinical specimen...
Ngày tải lên: 06/03/2014, 04:20
C-Reactive Protein in Patients with Pulmonary Tuberculosis ppt
... might prevent the development of incurable reactive systemic complications of pulmonary tuberculosis It is concluded that CRP can serve as a sensitive indicator of activity of the disease and the ... three consecutive days The evidence of apical cavitations on chest radiographs and any one positive smear of sputum for AFB were considered as cases of pulmonary tuberculosis CT scan of chest and ... 10], chronic infections and asthma [11, 12] The objective of the present study was to assess changes in the concentration of CRP in patients with pulmonary tuberculosis infection The CRP can serve...
Ngày tải lên: 15/03/2014, 03:20
EG-INTERFERON ALFA -2a VÀ RIBAVIRIN ĐIỀU TRỊ BỆNH NHÂN VIÊM GAN SIÊU VI C MÃN TÍNH ĐÃ THẤT BẠI VỚI ĐIỀU TRỊ TRƯỚC ĐÓ potx
... viral response Virus load only affected sustained viral response in nonrespond group Dose reduction of Peginterferon or Ribavirin not cause any influences on sustained viral response In conclusion, ... will have much of success Dose reduction of Peginterferon or Ribavirin not cause any influences on sustained viral response I.GIỚI THIỆU: Nhờ thành tựu khoa h c , sau 15 năm qua vi c chẩn đoán ... cho đáp ứng virus cuối trị liệu thấp nhóm II , nhiên kh c biệt chưa c ý nghĩa thống kê ( 41,26%vs 55,55%, p>0,05) Nhưng đáp ứng virus bền vững c kh c biệt rõ ràng , nhóm I (nonresponder) cho...
Ngày tải lên: 27/07/2014, 10:21
Tài liệu Báo cáo khoa học: Analysis of oxidative events induced by expanded polyglutamine huntingtin exon 1 that are differentially restored by expression of heat shock proteins or treatment with an antioxidant ppt
... NAC Hsp27 Hsp70/Hdj-1 103Q EGFP vector Control Hsp27 Hsp70/Hdj-1 72Q EGFP vector Control Hsp27 25Q EGFP vector Hsp70/Hdj-1 Hsp27 Control Hsp70/Hdj-1 EGFP vector Control A kDa 54 37 29 20 B C ... with pCIneo vector or vectors bearing the Hsp70 ⁄ Hdj-1 (+ Hsp40 + Hsp70) or Hsp27 (+ Hsp27) coding sequence NAC (2 mM) was added (+ NAC) to the culture medium 24 h after transfection of the cells ... increase in fluorescence that reflects accumulation of intracellular ROS levels in COS-7 cells transiently transfected with httEx1-polyQ-EGFP vectors To analyze the effects on ROS mediated by Hsp...
Ngày tải lên: 19/02/2014, 06:20
Báo cáo y học: "Proteome analysis of bronchoalveolar lavage in Pulmonary Langerhans cell histiocytosis" pptx
... coverage peptide (%) Folds in Localization nsc sc PLCH 1-way ANOVA p value Nsc-sc NscPLCH ScPLCH Mascot search result PLCH< nsc and/or sc 25 26 Polymeric immunoglobulin receptor Thioredoxin P01833 ... Virchow JC, Lommatzsch M Functionassociated surface molecules on airway dendritic cells in cigarette smokers Am J Respir Cell Mol Biol 2008;38(6):655-60 Soler P, Moreau A, Basset F, Hance AJ Cigarette ... Mascot search result No of Sequence Score matched coverage peptide (%) Folds in Localization Nsc-sc NscPLCH ScPLCH PLCH< nsc and/or sc 25 26 Polymeric immunoglobulin receptor Thioredoxin P01833 5.58...
Ngày tải lên: 10/08/2014, 09:22
báo cáo khoa học: "A nanocomplex that is both tumor cell-selective and cancer gene-specific for anaplastic large cell lymphoma" ppt
... Aptamer-mediated specific cell binding Cell counts (%) C Ratio of CD30 aptamers to Cy5-ssDNA 1:1 1:2 1:5 1:10 Carrying capacity and specific cell binding Karpas 299 cells with no treatment Treated with nanocomplexes ... cancer gene-specific for ALCL The nanocomplexes are specific and noncytotoxic to lymphoma cells, which advance great potential for their clinical applications Page 10 of 12 structure (nanocore) was ... targeting Cells were treated with the luciferase-specific siRNA nanocomplexes and days post-treatment, luciferin was added to the cell cultures and luciferase activity detected by bioluminescence scanning...
Ngày tải lên: 11/08/2014, 00:22
Báo cáo khoa hoc:" Diffuse idiopathic pulmonary neuroendocrine cell hyperplasia (DIPNECH) in association with an adenocarcinoma: a case report" ppsx
... idiopathic pulmonary neuroendocrine cell hyperplasia and a typical carcinoid tumor J Thorac Cardiovasc Surg 2006, 131:1207-1208 Gosney JR: Diffuse idiopathic pulmonary neuroendocrine cell hyperplasia ... hyperplasia; CK7 = cytokeratin; CK18 = cytokeratin 18; TTF1 = thyroid transcription factor 1; SPA = surfactant protein A; CEA = carcinoembryonic antigen; NSE = neuron specific enolase Competing interests ... no predictive histological or genetic data available so far However, it has become generally accepted that DIPNECH is a precursor to pulmonary carcinoid tumors [3] In a recent study including...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: " Profiles of cytokine and chemokine gene expression in human pulmonary epithelial cells induced by human and avian influenza viruses" doc
... ATTCTGCGCAGCTTTAAGGA GAGGTGCCCATGCTACATTT IL-8 TGTGCCTTGGTTTCTCCTTT GCTTCCACATGTCCTCACAA TGF-beta-2 CCAAAGGGTACAATGCCAAC TAAGCTCAGGACCCTGCTGT TNF-alpha CCTGGGATTCAGGAATGTGT AGGCCCCAGTTTGAATTCTT ... real-time PCR assays Amplification target Forward primer (5’-3’) Reverse primer (5’-3’) CCL-5/RANTES CCCCATATTCCTCGGACACCACA GTTGGCACACACTTGGCGGTTC CXCL-10/IP-10 TCGAAGGCCATCAAGAATTT GCTCCCCTCTGGTTTTAAGG ... AGGCCCCAGTTTGAATTCTT Beta-actin GCACGGCATCGTCACCAACT CATCTTCTCGCGGTGGCCT Primers for cytokine/chemokine detection and primers for actin detection instructions The quality of RNA in the extracted preparation...
Ngày tải lên: 12/08/2014, 02:20
Báo cáo y học: " KL-6 concentration in pulmonary epithelial lining fluid is a useful prognostic indicator in patients with acute respiratory distress syndrome" ppt
... http://respiratory-research.com/content/12/1/32 Page of fluid; BMS: bronchoscopic microsampling; ELF: epithelial lining fluid; ILD: interstitial lung disease; ROC: receiver operating characteristic Acknowledgements ... 60 40 20 AUC=0.841 AUC=0.732 0 20 40 60 80 100% 100% - Specificity 20 40 60 80 100% 100% - Specificity Figure ROC curve analyses to determine the optimal cutoff values of KL-6 concentrations ... et al Respiratory Research 2011, 12:32 http://respiratory-research.com/content/12/1/32 the S-S bond near the surface of the epithelial cell membrane, KL-6 can diffuse into pulmonary epithelial...
Ngày tải lên: 12/08/2014, 13:22
Báo cáo y học: " Protection of pulmonary epithelial cells from oxidative stress by hMYH adenine glycosylase" pptx
... http://respiratory-research.com/content/5/1/16 Passaging of cells was performed every 3–4 days with cells grown to 80% confluency in a 10 cm cell culture dish (Corning Incorporated, Corning, NY) Cells ... protection under conditions of increased oxidative stress Methods Cell Culture The human alveolar epithelial cell line A549 (58 year old Caucasian male), was purchased from ATCC Cat No CCL185 ... peroxidase which directly reduces H2O2 and lipid peroxides Free radical scavengers, which stop free radical chain reactions by accepting electrons, include α-tocopheral (vitamin E), ascorbic acid (vitamin...
Ngày tải lên: 12/08/2014, 18:21
Báo cáo y học: "Atorvastatin reduces lipopolysaccharide-induced expression of cyclooxygenase-2 in human pulmonary epithelial cells" ppsx
... primers, 35 cycles), and CYCLOPHILIN A: forward: 5'-ATG GTC AAC CCC ACC GTG TTC TTC G3' and reverse: 5'-CGT GTG AAG TCA CCA CCC TGA CAC A-3', which yielded products of 206 bp (50 sec at 55 C for annealing ... lipopolysaccharide (LPS)-induced expression of COX-2 in cultured human pulmonary epithelial cells http://respiratory-research.com/content/6/1/27 which yielded products of 342 bp (50 sec at 55 C for ... the access RT-PCR System The following primers were used for COX-2: forward: 5'-AAG CTG GGA AGC CTT CTC TA3' and reverse: 5'-TTT CCA TCC TTG AAA AGG CGC-3', 2.5 Western Blot analysis After incubation,...
Ngày tải lên: 12/08/2014, 18:21
Hoàn thiện công tác tổ chức kế toán phi sx và phương pháp tính giá sp.pdf
... hạch toán Hệ thống kế toán chi phí sản xuất tính gi thành sản phẩm theo chi phí đònh m c CPSXDD CP NVL TT CPSXDDK THÀNH PHẨM CPĐM GIÁ VỐN HB CPĐM CP Th c tế CP NVL TT CP Th c tế CP SXC CP Th c ... th c đònh m c chi phí Chính kỳ doanh nghiệp x c đònh giá thành theo chi phí đònh m c, cuối kỳ kế toán x c đònh m c chênh lệch thay đổi đònh m c chênh lệch đònh m c với th c tế tiến hành điều chỉnh ... theo chi phí th c tế kết hợp với ư c tính Error! NVL TT CP CPSXDD CP Th c tế CPSXDD THÀNH PHẨM GIÁ VỐN HB CPTT kết hợp ƯT CPTT kết hợp ƯT (4) (5) (1) CP NVL TT CP Th c tế (2) CP SXC CP ư c tính...
Ngày tải lên: 23/11/2012, 16:44
Giải pháp nâng cao khả năng cạnh tranh của các sản phẩm nội thất ở C.ty Xuân Hoà
... khách hàng C c cửa hàng, đại lý c ng ty Hà Nội nh khu v c kh c miền B c đ c cán tiếp thị chăm s c chu đáo, cung c p kịp thời thông báo, định c ng ty Đối với đại lý miền Nam, miền Trung c ng ty c ... vụ Tổ ch c tốt c ng t c sau bán hàng Dịch vụ kèm sản phẩm c ng c c nh tranh mang lại hiệu cao vi c cạnh tranh tr c tiếp sản phẩm nên c ng ty ý đến c ng t c Công ty Xuân Hoà th c vi c bảo hành ... điều kiện để c ng ty c nh tranh với hãng kh c Tăng c ng c ng t c chăm s c khách hàng Theo quan niệm Maslow thứ b c nhu c u ( b c nhu c u ) ngời, nhu c u b c dới đ c thoả mãn nhu c u b c xuất Vậy...
Ngày tải lên: 04/12/2012, 10:36
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... Cloning of the Klebsiella phytase gene (phyK) The Klebsiella phytase gene phyK was amplified using primers KlebTH-fw (5¢-TCGGATCCGCCGCCGCGCGAC TGGCAGCTG) and KlebTH-rv (5¢-CCGGCGGTAGC CATGGTCCTGCCGAAGCTT) ... substrate specificity but low speci c activity for phytate, whereas others have narrow substrate specificity and high speci c activity for phytic acid All members of the HAP class share two conserved active-site ... mutagenesis kit (Stratagene, La Jolla, CA, USA) Plasmid pET-1TK was used as template and Kleb(HtoA)fw (5¢-GCTTAGCCGCGCCGGCATTCG) and Kleb(HtoA)rv (5¢-CGAATGCCGGCGCGGCTAAGC) as primers for FEBS Journal...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
... back muscle of rabbit by RT-PCR using the primer set, RTnI1F (5¢-CAAACCTCACCATGGGAGAT GAAG-3¢) and RTnI181R (5¢-CCCCGGAGCCGGATCC CCAGCCCC-3¢) These primers were designed based on the sequence ... 232–292), combinations of the forward and reverse primers, ATnI1F (5¢-CATATCACCATGGGTTCCCTTG-3¢) and ATnI292R (5¢-CTTGATTTGGATCCTTTAAGGTA TAGC-3¢), ATnI1F and ATnI128R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢), ... ATnI130F (5¢-GCCAGAA CCATGGCGGAGGAAC-3¢) and ATnI292R, ATnI130F and ATnI252R (5¢-CAAGTTTGGGATCCTATTTGTTAA CTTTTC-3¢), and ATnI232F (5¢-CGAGATTAATGCC ATGGCACTTAAGG-3¢) and ATnI292R, respectively, were...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: A unique variant of streptococcal group O-antigen (C-polysaccharide) that lacks phosphocholine ppt
... monoclonal antibodies that detect phosphocholine and the backbone of pneumococcal C- polysaccharide, respectively, as an indication of the presence of an antigen identical or closely similar to C- polysaccharide ... identical except that the characteristic phosphocholine residues of pneumococcal C- polysaccharide are absent from the new S mitis C- polysaccharide, which is substituted with ethanolamine (structure ... streptococci: Description of Streptococcus gordonii sp nov & emended descriptions of Streptococcus sanguis (White and Niven 1946), Streptococcus oralis (Bridge and Sneath 1982), and Streptococcus...
Ngày tải lên: 20/02/2014, 11:20