... networking, and then looks in more detail at Linux networking on a Local Area Network (LAN). In the next two chapters, you'll learn about making a dialup Internet connection, and setting up ... a message to every system on the local area network. Often you can determine the broadcast address of a local area network from the address of a system on the local area network: simply replace ... Instead, it sends data packets to a designated computer - called the gateway - on the local area network. The gateway forwards data packets to the Internet on behalf of your system. It also performs...
Ngày tải lên: 14/12/2013, 13:15
... configuration files reside in the directory /etc/apache. For historical reasons that no longer apply, Apache has three configuration files: access.conf Specifies what hosts and users are allowed access ... Linux wide-area network servers, including an FTP server, a web server (Apache), an email (SMTP/POP) server, and a dial-in shell server. These applications let you and others access data on your ... You can scan them to see what options are available and specify options that interest you. A more complete description of the options is available in Apache's online documentation. Also,...
Ngày tải lên: 14/12/2013, 13:15
How to Be a Successful Life Coach: A Guide to Setting Up a Profitable Coaching Business docx
... their managers & You can attend a course which offers a formal qualification such as a diploma & You can gain hands-on coaching experience – as a manager, as a volunteer or as a self-employed ... coach Employer training My first coaching skills training took place when I was a manager in a large voluntary sector organisation The organisation wanted to improve its pool of applicants... ... in formal training and in practice Coaching. .. that anyone with any form of mental illness was unsuited to coaching either as a coach or a client Depression is a mental illness, a...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo sinh học: " genetic response possible in dairy cattle improvement by setting up a multiple ovulation and embryo transfer (MOET) nucleus scheme" ppt
... schemes-adult and juvenile In the adult scheme, animals are selected after the first lactation Males are evaluated on their full sibs’, half sibs’ and dam’s records; females are evaluated on the same ... of males and females Thus the average merit of breeding males born is: The average merit of all females born is: Thus the average merit of breeding males born at year one is D/2 These are mated ... ovulation and embryo transfer in small dairy herds Proa 30th Ann Meedng EAAP, Harrogate Nicholas F.W & Smith C (1983) Increased rates of genetic change in dairy cattle by embryo transfer and...
Ngày tải lên: 14/08/2014, 19:23
thảo luận tiếng anh 1.5 VCU Topic Factors to consider in setting up a business
... were organized efforts of of planners, organizers, leaders and controlers for us to have great constructions today like: Great Wall, Great Pyramid of Giza,… that means management activities appeared ... water and electricity costs if you are located in some areas The raw materials can be easily sourced, the manpower would easily available and you can save out on transportation costs in case ... accomplish goals • The role of information - Gather information from subordinates - Disseminate information from superiors [...]... places have advantage over the other You can save out on taxes,...
Ngày tải lên: 14/05/2015, 14:38
Setting Up a Limited Company 2 e Pocket Lawyer
... dividend as from a particular date that share shall rank for dividend accordingly 105 A general meeting declaring a dividend may upon the recommendation of the directors direct that it shall be satisfied ... every effort will be made to show any changes in the law that take place after the publication date on the companion website About the authors Mark Fairweather is a practising solicitor and is ... be accurate as at December 2003 The authors and publisher cannot accept liability for any advice or material that becomes obsolete due to subsequent changes in the law after publication, although...
Ngày tải lên: 13/10/2016, 11:16
Tính toán xây dựng hệ thống đồng phát nhiệt điện cho công ty dệt may (calculation and setting up a cogeneration unit for the textile company)
... đốt than công suất 150 MW KCN Nhơn Trạch III, huyện Nhơn Trạch, tỉnh Đồng Nai [18].http://www.scp.gov.vn/tin-tuc/t358/nha-may-giay-bai-bang-cong-nghe-cho-sanxuat-xanh.html [19] Carl R Branan Rules ... GIA THÀNH PHỐ HỒ CHÍ MINH TRƯỜNG ĐẠI HỌC BÁCH KHOA KHOA CƠ KHÍ - BỘ MƠN CƠNG NGHỆ NHIỆT LẠNH TÍNH TỐN XÂY DỰNG HỆ THỐNG ĐỒNG PHÁT NHIỆT ĐIỆN CHO CÔNG TY DỆT MAY (CALCULATION AND SETTING UP A ... Branan Rules of Thumb for Chemical Engineers Library of Congress Cataloging-in-Publication Data [20].https://www.red-bag.com/engineering-guides/249-bn-eg-ue109-guide-for-vesselsizing.html [21]...
Ngày tải lên: 04/12/2021, 22:00
Setting up a fanpage contributes to increase sales at PQ medical company
... considered for the ad run in April At the end of that ad run, I have collected 3 sources customer information and have signed a transaction for a hair removal machine sales product Average for a customer ... services and products III PROJECT TASKS 3.1 CREATE A FANPAGE After learning about the company, I learned that the company has a website but does not have a fan page that is really attractive to ... administration, ) - Organizational chart : General Manager Warehouse side department Warehouse management Warehou se staff Export staff Personnel administration department Technical department Repair technique...
Ngày tải lên: 09/10/2022, 22:54
Setting up and running a small-scale dairy processing business potx
... Lusaka, Zambia Maryline Simba, Simba Foods, PO Box 79360, Ubungo-Maziwa, Dar es Salaam, Tanzania Masoud Rizvi Fidahussein & Co., Vingunguti Industrial Area, PO Box 816, Dar es Salaam, Tanzania ... Chirstabel Malijani, Provincial Health Inspector, PO Box 37136, Lusaka, Zambia Claudia Mary Massawe, Clama Quality Product, PO Box 33496, Dar es Salaam, Tanzania M.T Kaputo, Food Technology Research ... 460, Cantonment, Accra, Ghana G.M Chingembu, CPL Kaposhi, PO Box 30060, Lusaka, Zambia Harrington Barigye, Information Officer, Uganda Manufacturers Association, PO Box 6966, Kampala, Uganda J...
Ngày tải lên: 18/03/2014, 00:20
Technical Committee of the International Organization of Securities Commissions : Principles for financial market infrastructures ppt
... Such arrangements typically are organised and managed by the CSD or SSS for a market or by some other market operator A guarantee typically is viewed as desirable or even necessary where market ... governance arrangements is appropriate for all FMIs and all market jurisdictions Arrangements may differ significantly because of national law, ownership structure, or organisational form For example, ... serve as a reliable central data source The continuous availability of data stored in a TR is also essential Specific operational risks that a TR must manage include risks to data integrity, data...
Ngày tải lên: 15/03/2014, 10:20
Roles, authority and involvement of the management accounting function: a multiple case-study perspective ppt
... Public MA OM MA Agape MA MA MA MA 46 Siegeauto Franceauto Gastryx MA MA MA 27 - 41 - Table - Dimensions and Features of the Management Accountant’s Activity Activity of Management Accountants Zones ... management accountants or with operational managers Task-based image: added value, assistance in decision making Relational image: from spy to partner Self Image Organisational identity: attachment ... words, in each firm we added additional informants until we began to hear the same information again and again, indicating that we had reached what Glaser and Strauss (1967) refer to as “theoretical...
Ngày tải lên: 23/03/2014, 03:20
Báo cáo khoa học: " Is there a special mechanism behind the changes in somatic cell and polymorphonuclear leukocyte counts, and composition of milk after a single prolonged milking interval in cows" pptx
... purposes) Acta Veterinaria Scandinavica 2009, 51:4 lactation and in lactation number or The herd is comparable to an average Swedish dairy herd regarding lactation stage and age distribution among ... repeated measure ANOVA (Analysis of Variance) in SAS 9.1 (SAS Institute, Cary, NC, USA, 2002) To obtain normal distribution, the data on SCC were transformed to 10 logarithmic values before the analysis ... interaction of group and day The other effects are defined as in model Page of 10 (page number not for citation purposes) Acta Veterinaria Scandinavica 2009, 51:4 After analysis it was revealed...
Ngày tải lên: 12/08/2014, 18:22
beasley - 1996 - an empirical analysis of the relation between the board of director composition and financial statement fraud
... duplicate AAERs for same firm) * AAERs affecting firms with no available proxy or financial statementdata * AAERs affecting banks or insurancefirms experiencing financial statementfraud * AAERs affecting ... financial statement fraud accounts for about half the litigation cases against auditors Auditors are required by AICPA SAS No 55, Consideration of the Internal Control Structure in a Financial Statement ... Words: Audit committees, Board of director composition, Corporate governance, Financial statement fraud Data Availability: Data for this paper come from public sources A list of sample firms is available...
Ngày tải lên: 02/01/2015, 17:34
Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf
... threedimensional X-ray structure of active [34] and latent [13] PAI-1 Statistical analysis Data were evaluated by Student’s t-test Table Specific inhibitory activity of PAI-1 variants towards uPA The ... specific inhibitory activity of the reactivated PAI-1 variants was measured by titration against uPA in a direct peptidyl anilide assay at 37 8C, in the presence or absence of a slight excess ... for uPA The amount of active PAI-1, and thus the specific inhibitory activity, was calculated from the total amount of PAI-1 that had to be present to inhibit half of the uPA activity in the assays...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo khoa học: Protein transport in organelles: The composition, function and regulation of the Tic complex in chloroplast protein import pptx
... 58 Tanaka R, Hirashima M, Satoh S & Tanaka A (2003) The Arabidopsis-accelerated cell death gene ACD1 is involved in oxygenation of pheophorbide a: inhibition of the pheophorbide a oxygenase activity ... colleagues from the laboratory for helpful discussions, and especially Anna Stengel for critical reading of the manuscript Financial support was provided by the Deutsche Forschungsgemeinschaft Grant ... regulation by calcium/CaM is considered to be a eukaryotic trait, import analyses into chloroplasts could demonstrate that organellar processes have been integrated into the calcium signalling network...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Delineation of the roles of FadD22, FadD26 and FadD29 in the biosynthesis of phthiocerol dimycocerosates and related compounds in Mycobacterium tuberculosis pptx
... fadD22C TCACGGGTCGCATCAAGGAGC fadD22J ACAACATATGCGGAATGGGAATCTAGC fadD22K ACAAAAGCTTCTTCCCAAGTTCGGAATCGA fadD26F CATAGTGAACGCCAGAAAGCCG fadD26G TAGGTAGTCGATTAGCCAGTGG fadD26K ACAACATATGCCGGTGACCGACCGTT ... CCGACTCGGATTCGTATGAAAG fadD29F GTTATGCCATAGCATCTAGGC fadD29I ACTTCGCAATGAAAACCAACTCGTCATTTC 2949H ACTTCGCAATGACCGAGTGTTTTCTATCTG 2949I ACAAAAGCTTTATTGGATGACCGCCCTAG res1 GCTCTAGAGCAACCGTCCGAAATATTATAAA ... ACAACATATGCCGGTGACCGACCGTT fadD26L ACAAAAGCTTCATACGGCTACGTCCAGCC fadD2 9A GCTCTAGAGTTTAAACCGCGCTCGGGGTACCTGG fadD29B GCGCGGCCGCGTTTAAACCGATCGCGCAGCGCATC fadD29C TCGCGACGACGTGGAAGAGGC fadD29D ATCGGTTCGTAGCCTCCAGGC fadD29E...
Ngày tải lên: 15/03/2014, 11:20
Report of the Sub-Committee of the Central Board of Directors of Reserve Bank of India to Study Issues and Concerns in the MFI Sector doc
... sector but is also a participant, in that it finances the sector There may be a perceived conflict of interest if NABARD is also a regulator If therefore, NABARD is to act as a regulator, it may ... customers and that there are adequate safeguards to detect and correct corruption or unacceptable behaviour h) Accountability 26 i) A declaration that the MFI will be accountable for strictly ... will apply to all microfinance organisations other than: a) banks; b) co-operative societies engaged primarily in agricultural operations or industrial activity or purchase or sale of any goods and...
Ngày tải lên: 15/03/2014, 14:20
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
... pET2 8a( +)-wild-type Ec DosH as a template and using the following respective 5¢-sense primers: 5¢-gatga gtcgggagACCcagctggagaaaaaag-3¢, 5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢, 5¢-ggacccgttttgcgACCtcgaaagtgagc-3¢, ... Continuum, Santa Clara, CA, USA) with the fundamental radiation of 1064 nm The monitoring light was produced using a 150 W xenon lamp (Hamamatsu Photonics, Hamamatsu, Japan) The peak power of the laser ... nitrilotriacetate ⁄ agarose chromatography (Qiagen, Valencia, CA, USA) Final purification was by Sephadex G-75 column chromatography SDS ⁄ PAGE and subsequent staining with Coomassie Brilliant Blue...
Ngày tải lên: 16/03/2014, 13:20
corporate video production beyond the board room (and out of the bored room)
... Through advocacy and innovation, Schwab has worked to make investing more affordable, more accessible, and more understandable for all For more than three decades, the Charles Schwab Corporation has ... with a storage area network (SAN) and network attached storage (NAS) to share media Marino says that their file-based workflows enable editors to collaborate on projects and manage assets efficiently ... MediaGrid is a cross-platform storage system that also supports the company’s transcoding and streaming applications According to Dan Pryor, Vice President of Corporate Communications at Safeway,...
Ngày tải lên: 30/05/2014, 23:13