... QuickTime™ and a decompressor are needed to see this picture ...
Ngày tải lên: 07/05/2016, 00:41
... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... and humans Some of these human and avian influenza viruses might become adapted to pigs and circulate in that population The cocirculation of the viruses in swine, avian and human populations ... horses, seals, whales, and many types of birds as well as humans This can be a trans-species virus Type B infects only humans [8] Animals act as reservoirs for this influenza virus and Gelbalt [7]...
Ngày tải lên: 02/11/2012, 11:12
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis
Ngày tải lên: 06/11/2012, 10:35
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis
... Vietnam national University, Hanoi College of Foreign Languages Department of Postgraduate Studies A study oF An alternative approach to teaching essay writing to TOEFL learners (Nghiên ... learners (Nghiên cứu Đổi phơng pháp dạy viết Luận cho học viên chứng ToefL) By: Nguyen Thi Chung Mien Supervisor: Do Ba Quy, MA Hanoi, 2005 ...
Ngày tải lên: 06/11/2012, 10:35
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis
... familiar with Agreeing and Disagreeing, Giving an Explanation or Making an Argument Some thought that Cause and Affect pattern of essay organization should be paid more attention to TWE preparation It ... Agreeing and disagreeing (AD); Stating a preference (PR); and Giving an explanation (EX) that learners can flexibly apply to their writing with each pattern of essay organization Sometimes, a combination ... organizations of cause and effect essay: block and chain In block organization, all the causes are discussed as in a block and the all the results are mentioned in another block In chain organization,...
Ngày tải lên: 06/11/2012, 10:35
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis
... have to some extent, a great affect on them They interact and play with each other and can give them advice immediately Moreover, they are at the same or around age so they can more easily to ... parents are important teachers when children are small but they cannot be the best ones all the time There’s still a gap between children and parents in every family WRITING PAPER Name: Group A Paper: ... need to learn from other sources WRITING PAPER Name: Group A Paper: 02F6g Task: 02 AD Write: It’s said that parents are always the best teachers but we strongly disagree with the above statement...
Ngày tải lên: 06/11/2012, 10:35
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY
... competitive market Although a company gets many benefits from its brand name, it is not easy to create and maintain a strong brand To understand more how a company builds and manages its brand to get ... task for any company in a highly competitive market Although a company gets many benefits from its brand name, it is not easy to manage a strong brand To understand more how a company builds and ... Internet, and other sources Data analysis: Qualitative analysis was done for secondary data and primary data collected from interviews Quantitative analysis was done for primary data collected...
Ngày tải lên: 13/04/2013, 10:29
Use of an extension of the park's transformation to determine control laws applied to a non sinusoidal permanent magnet synchronous motor
... motor being not supply Park's transformation AAer this first transfoxmation, the Pa& transfomation allows us to work in the rotor's reference, through a rotation of an angle PO.Using the new variables ... Park's transfonnation permits us to have a best knowledge of the non sinusoidal permanent magnet synchronous motor We are so able as well to analyse the classical control laws such as 120' voltage ... so reduce to a two-phase system in the "a- p" kame For a non-sinusoidal machine can be not equal to zero, and then a zero-sequence current can be useful The Conmrdia's transfonnation has no more...
Ngày tải lên: 03/01/2014, 19:50
Tài liệu Creating an XML File That Shows Changes Made to a DataSet pptx
... Here are descriptions of the three DiffGram sections: The DataInstanceName is the name of the DataSet or DataTable This block contains the current version of the data containing ... original and current values for the contents of a DataSet It does not include any schema information The DiffGram is also the primary serialization format used by the NET Framework to persist and ... the section Elements in this section are matched to elements in the section using the diffgr:id annotation with matching values The example loads all Categories...
Ngày tải lên: 21/01/2014, 11:20
The Key to a Winning Sales Message
... whether your sales message is any good Print it out and, with a red pen, circle every adjective and adverb (i.e telling) Then underline any facts that might actually spark an emotional response ... somewhere around $1 million a year." Needless to say, you'll need to back up that claim with additional facts and success stories However, rather than telling the customer that your product is "exciting" ... rewrite the message so that it shows rather than tells Here's a real life example: By editing out the biz-blab and showing rather than telling, we end up with the following message, which is far more...
Ngày tải lên: 06/02/2014, 17:14
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA ... TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC ... elucidated a mammalian 5¢- to 3¢ ARE decay pathway that is localized to P-bodies via an ARE interaction with tristetraprolin and BRF1 [41–44] However, both 5¢- to 3¢ and 3¢- to 5¢ pathways can be...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu HOW TO: CONDUCT AN EMAIL AUDIT ppt
... etc.) and formulate a plan for addressing those issues As always, you will want to test any changes with a limited – and closely monitored – mailing list Then you can gauge the results and make ... out a few actionable items you can test or address right away SECTION 5: HOW TO: TRACK AND MANAGE YOUR CLICKTHROUGH AND BOUNCE RATES Analytics (the term for statistics related to your email and ... company’s email marketing campaign Email audit is a broad term that can mean a variety of speciic tasks The common thread, though, is the assessment of your email marketing process (or other email...
Ngày tải lên: 17/02/2014, 21:20
Tài liệu C++ Lab2 Sending the output to a printfile Data Types pptx
... You can substitute the data type used inside the parenthesis Before manipulating a variable, you must assign a value to it You can assign a value at the time you declare a variable – we call this ... (word varies on different machines) A 32 bit machine will set aside bytes for an int that can hold any value from -2,147,483,648 to +2,147,483,647 A char data type can hold one character and it ... initializing a variable Or you can read a value from a file or the keyboard Homework: Write a program to find the average of three grades for a student Display the name of the student and the average...
Ngày tải lên: 20/02/2014, 08:20
Tài liệu C++ Lab 2 Sending the output to a printfile Data Types: Chapter 2 ppt
... Here is an example of a programming assignment Write a program to determine how many quarter rolls, dime rolls, nickel rolls and penny rolls in a given amount of dollars Let us understand this ... dollars % 10 calculate dime rolls and remainder dime_rolls = remainder / remainder = remainder % calculate nickel rolls and remainder nickel_rolls = remainder / remainder = remainder % calculate ... the main int dollar, quarterR, dimeR, nickelR, pennyR, remainder; Variables that are used in the main are declared There are six variables of type integer These variable names (identifiers) stand...
Ngày tải lên: 20/02/2014, 08:20
Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf
... necessarily mean that translation starts from a downstream AUG, as predicted by genome and mRNA analysis, but raises the possibility that the translated form may have used a CUG start codon with an ... from an 83-year-old man and a 71.0 g sample of occipital cortex from a 85-year-old man with a short (25 h) post mortem delay RNA isolation, reverse transcription and 5Â-RACE Total RNA was isolated ... trypsinogens are predictors of distant metastasis and survival in early-stage non-small cell lung cancer Cancer Res 64, 55645569 21 Marsit CJ, Karagas MR, Danaee H, Liu M, Andrew A, Schned A, Nelson...
Ngày tải lên: 07/03/2014, 10:20
“MURPHY” A MESSAGE TO DOG-LOVERS docx
... to learn any Perhaps Dan, whose repertory was large, had told him what a bore they were, and cautioned him to his utmost to avoid them 111 VIII About a year after Murphy’s arrival, Dan was gathered ... as an interloper, 38and when he could anything to frighten him he did, and by any brutal means in his power Even the mill-hands remarked to one another that their mate, Moby, was a changed man ... that majority Man was his friend Friendship meant loyalty, and loyalty should be unstained There was much in what he said On many an occasion a dog will show that he knows better than a man, and...
Ngày tải lên: 15/03/2014, 14:20
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc
... compensation The mai-baap manager The Indian manager has a unique role to play, that of mai-baap (mother-father, that is, parents) Many team members also expect the manager to play almost a parental role ... corporate, as well as a startup He maintains a blog at http://pankajghanshani.com, and you can follow him on Twitter at @PankajGhanshani and find him on Linkedin at http://www.linkedin.com/in/pankajghanshani ... Coordinator Vishal Bodwani Proofreader Aaron Nash Kishore Shenoi Pankaj Ghanshani Indexer Tejal Daruwale Acquisition Editors Amey Kanse Kartikey Pandey Lead Technical Editor Kartikey Pandey Technical...
Ngày tải lên: 23/03/2014, 13:20