Ngày tải lên: 23/02/2014, 02:20
... of the equipment and contact information for their safety department or representative EHS will review the proposed buyer's information and make a recommendation approving or disapproving the ... of the owner of the equipment to drain the equipment and arrange for disposal of the hazardous materials through EHS before requesting the system be picked up by Lion Surplus e Class 1, 2, and ... email to EHS acknowledging their experience and awareness of the hazards associated with the equipment The letter must state the intended use of the equipment and include their safety department...
Ngày tải lên: 23/03/2014, 23:20
ACCOUNTING FOR CAPITAL PROJECTS: Financial Policies and Procedures for the Capital Project Delivery Process pptx
... Policies and Procedures for the Capital Project Delivery Process • Project Initiation • Procedures for Design and Construction • Other Accounting Procedures • UCONN 2000 Project Audits Procedures for ... Accountant Financial Policies and Procedures for the Capital Project Delivery Process • Project Initiation • Procedures for Design and Construction • Other Accounting Procedures • UCONN 2000 Project ... as needed Financial Policies and Procedures for the Capital Project Delivery Process • Project Initiation • Procedures for Design and Construction • Other Accounting Procedures • UCONN 2000 Project...
Ngày tải lên: 29/03/2014, 20:20
Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt
... CTTCATTTGTTATTCGACTT) and PVM2 (Forward: ATGGGAGATTCAACRAAGAA) were used for amplifying the entire CP gene and the nucleotide sequences of the amplicons (917 bp) were then determined in both directions using the ... group I might be further divided into two sub-groups - Ia, and Ib PVM isolates from China and Poland formed the group Ia and group Ib consisted of isolates from Italy, Germany and Russia Isolates ... RT-PCR and RFLP procedures were developed for the detection and identification of PVM in potatoes Composite leaf or tuber samples can be used in PCR tests to reduce the time and cost needed for...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: " Clinician performed resuscitative ultrasonography for the initial evaluation and resuscitation of trauma" pptx
... as the "pleural line", represents the parietal and visceral pleural interface Together, the upper rib, pleural line, and lower rib form a Page of 14 (page number not for citation purposes) Scandinavian ... contusion, and aspiration [64-66] Since these artifacts originate from the parenchymal surface of the lung, their presence within the ultrasound field implies the apposition of the parietal and visceral ... distensible part of the sheath, and giving the most reproducible results (Figure 12) [110,111] For each optic nerve two measurements are made–one in the sagittal plane and the other in the transverse...
Ngày tải lên: 13/08/2014, 23:20
Ethernet networking for the small office and professional home office
... connector to them.) Unfortunately, the wires in the cable tend to leak signals to one another The closer the wires are bound and the longer they get, the worse the interference Therefore, parallel ... the network The server processes the request and sends back unformatted, raw data to the client The client's software then formats the data for display to the end user In other words, the data manipulation ... easier to handle than earlier standards Note: For more information on these earlier Ethernet standards, see Appendix A 1995: The standard for 100 Mpbs Ethemet was approved This is the slowest...
Ngày tải lên: 21/08/2013, 08:05
Correspondence for the Application Process and the Job Search
... the reader • It enables the writer to state clearly why an organization is of interest to him or her • It opens the door for further communication and follow-through The essential structure and ... vitae and a set of slides, which describe the diversity of my photographic techniques, the equipment, and the materials I use in producing them Should you plan to attend the Art in Urban Landscape ... Newspapers and the Associated Press My most recent publication is the second edition of my book, Technical Documentation on the Internet Correspondence for the Application Process and the Job Search...
Ngày tải lên: 25/10/2013, 18:20
Mcgraw Hill 400 Must Have Words For The Toefl - Government and Justice
... a concentrated form, or even modify them of operations, the chemically to make them more potent and therefore more word then appears valuable Other cartel members then transport the drugs to very ... gold and silver, and then intentionally killed the king anyway.Their conquest of Peru established the legendary Spanish Main— Spanish holdings on the mainland of Central and South America The ... characters that operated from the island of Hispaniola They conducted merciless raids on Spanish settlements and formed a brotherhood known for theft, torture, smuggling, and villainy of all sorts...
Ngày tải lên: 01/11/2013, 15:20
Tài liệu Introduction for the security : Networks and exchanges of data Computer security The risks ppt
... lot of data and information For the live of the company, they're critical If in the network, the security is bad, the information can be divulged and the system's properties Question : The persons ... changed the technology The Intranets, the private networks inside the companies appear all over the world and grow The benefits are important : The paper before and now the electronic ... effectives Distribution of the information is better The interconnection for all these networks use Internet for the simple reasons : Data shared with the clients and the partners Propose different...
Ngày tải lên: 09/12/2013, 17:22
Tài liệu Long-Term Care for the Elderly: Challenges and Policy Options pptx
... does not, the demand for private insurance would be reduced since the subsidies would allow them to pay for their longterm care without drawing on their assets For this reason, the demand for private ... Once the public share is set, a key priority for government, therefore, is to ensure that citizens understand the private burden of care costs, and to emphasize the need to plan for them Value for ... either in home care or in institutional care In Finland, the size of the voucher depends on household composition and income, and patients pay the difference between the size of the voucher and...
Ngày tải lên: 13/02/2014, 18:20
Tài liệu GLOBAL STRATEGY FOR THE DIAGNOSIS, MANAGEMENT, AND PREVENTION OF CHRONIC OBSTRUCTIVE PULMONARY DISEASE pptx
... provides state-ofthe-art information about COPD for pulmonary specialists and other interested physicians The document serves as a source for the production of various communications for other audiences, ... not the only cause of COPD, and it may not even be the major cause in some parts of the world Furthermore, not all smokers develop clinically A major part of the GOLD report is devoted to the clinical ... on the COPD management The full Committee then reaches a consensus on whether to include it in the report, either as a reference supporting current recommendations, or to change the report In the...
Ngày tải lên: 21/02/2014, 12:20
Board Engagement, Training and Reporting: Strategies for the Chief Ethics and Compliance Officer pptx
... supporting it At the same time, the CECO needs to have face time before the Board to articulate the context for the reports and gain the confidence and support of the Board for the program and continued ... of the C&E program? What is the method and frequency of C&E reporting to the board, and of board contact with the CECO? How will the board obtain and evaluate the appropriate training and information ... have unfiltered access to the CEO and board? Has the board passed a resolution setting out the express mandate for the CECO and the compliance function? What are the full- and part-time resources...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo " Methodology for the waste quantity and quality measurement " pptx
... Preparation 1) Make the boundary, collect the economy and social information, and unify the sample size and household’s income level 2) Make the guiding document is clearer and more detail then organizing ... in the table g) Moisture depended on the weather; the average results in the sunny day are displayed in the table Table The average results in the sunny day, Phan Chu Trinh and Nguyen Du wards ... 5%, leather and rubber is 1%, other waste is 18% (The average result of surveyed wards) In Phan Chu Trinh and Nguyen Du, the easily decomposed waste ratio is 48.5%, this ratio is 44.6% and the total...
Ngày tải lên: 14/03/2014, 10:20
Competencies for the Specialist Paediatric and Child Health Nurse pptx
... check form filled out in the Baby's record, and copy inserted into notes), also documenting the appointment for the following week and the statistics for the FACH On return to the other Clinic, ... through the provision of information, resources and support • provides information to assist the child and family to understand the roles and functions of members of the health care team and technology ... compassion and fosters the development of these in others Competency 1.5 Respects the dignity and integrity of the child and family including their values, spiritual and cultural beliefs Performance...
Ngày tải lên: 22/03/2014, 09:20
Báo cáo " Changing for the better: Challenges and Opportunities" pptx
... papers according to certain themes to find the new words, form new sentences with those words and summarize the content of the papers. For their second year students, they would ask them to collect reading papers, list ... write the first version, and then they sat together to either select the best version to improve on or choose to combine the strengths of all the papers into the second ... it. They explained that during the play, they acted their roles seriously, wanting to succeed and making efforts to be accepted by others, so they had feelings that they were experiencing a real‐life ...
Ngày tải lên: 22/03/2014, 10:20
Windows Mobile Game Development: Building Games for the Windows Phone and Other Mobile Devices pdf
... redisplay the application, you need to navigate around the emulator a little First, click the Start button, and then choose the Settings option Inside the Settings window, open the System tab, and then ... versions of the operating system A couple of simple examples here are the form’s ControlBox (the “X” button in the top-right corner of the screen) and Button controls Neither of these exists in the smart ... take a closer look at the NET Framework, at the past and present of the Windows Mobile platform, and at some of the challenges that must be overcome to create games for the wide variety of hardware...
Ngày tải lên: 22/03/2014, 15:21
NATIONAL REPORT OF JAMAICA on MILLENNIUM DEVELOPMENT GOALS for the UN ECONOMIC AND SOCIAL COUNCIL ANNUAL MINISTERIAL REVIEW Geneva, July 2009 docx
... Policy for the elderly and a subsidy of over 80% for the rest of and Strategic Plan for the Promotion of the population (Table 8) These drugs from the VEN Healthy Lifestyles to tackle the increasing ... to the Convention on the Rights of the Child For example, the Child Care and Protection Act was passed in 2004, which strengthens the care and protection of children by introducing new standards ... educating them when they leave school during pregnancy, training them to care for their babies immediately after birth, and assisting them to re-enter the formal school system to complete their education...
Ngày tải lên: 23/03/2014, 06:20
Praise for the Photoshop Bibles and Deke McClelland docx
... can click the triangle and then click the name of the tool you want to use Or, to get the job done with one less click, just drag from the icon onto the name of the tool and then release the mouse ... choose the Open command from the File menu If you have to display a submenu to reach a command, I list the command used to display the submenu between the menu name and the final command Choose ... object-oriented text, the expanded TIFF and PDF file formats, free-form distortions, and the usual plethora of interface enhancements As always, we’ve reworked the structure of the book to suit the newest...
Ngày tải lên: 24/03/2014, 04:20