... EM-rand -10 K 32 12 8 1K 10 K 10 0 83.6 77.8 67.8 52.6 30.3 non-unique c non-c 10 0 89.0 81. 8 73.3 64 .1 47.33 10 0 10 0 10 0 99.7 99.8 99.9 33.3 17 .9 17 .7 24.0 24.4 log-lik stdev unif 2.9K 2.3K 874 270 220 15 0 ... initialized models was always smaller 465 setting 1K-unif-5 42.99 1K-rand-5 42.90 1K-unif-∞ 42 .10 1K-rand-∞ 41. 72 10 0K-unif-5 28.98 10 0K-rand-5 28.63 10 0K-unif-∞ 28 .18 10 0K-rand-∞ 27.95 IBM -1 mean ... 44.07 42. 61 28.99 28.22 max 45.08 43.63 30 .13 30 .13 22.53 22.26 28.09 27.88 12 .68 12 .25 16 .84 16 .66 HMM mean 22.99 28.47 12 .62 16 .78 max 24. 01 28.89 12 .89 16 .85 Table 2: AER results for Model and...
Ngày tải lên: 23/03/2014, 16:20
... Unicode Latin -1, có giá trị mật định “ISO-8859 -1 Code 4: pagedirective.jsp ... thời, tên máy, file truy cập Code 1: expression.jsp "1. 0" encoding="ISO-8859 -1" ?>
Ngày tải lên: 09/08/2014, 08:20
Kiến trúc 1 và 2 JSP (model 1 & 2architecture) - phần 2 pps
... version= "1. 0" encoding="ISO-8859 -1" ?> 21: HelloWorldTag.java ... sau, tag1 tạo đối tượng có tên obj1, sau sử dụng lại tag2 Qui tắc khuyến khích bảng đặt tả JSP, tag tạo tên với thuộc tính id tag thứ hai có thuộc tính name để dùng lại tên ...
Ngày tải lên: 09/08/2014, 08:20
Kiến trúc 1 và 2 JSP (model 1 & 2architecture) - phần 3 pps
... XEPLOAI (RB10) MANV&MACV khoá PHANCONG (RB 11) MAPER khoá PERMISSION (RB12) MAGROUP khoá GROUPS (RB13) MAPER & MAGROUP khoá GROUP_PER (RB14) MANV khoá ngoại GOPY tham chiếu từ NHANVIEN (RB15) MABC ... Công Việc Int > =1 Khoá > =1 Khoá Ngoại (FK) Chính (PK) MADA Mã Đề Aùn Int MADG Mã Đánh Giá Int TENCV Tên Công Việc Khoá Ngoại (FK) > =1 Text 20 NOI DUNG Nội Dung DAXONG DEAN Text 10 0 Đã Xong MADA ... Quyền Int > =1 Khoá Chính (PK) MA GROUP Mã Nhóm Int > =1 Khoá Chính (PK) MAPER Mã Quyền Int > =1 PERMI SIONS (PK) TENPER Text 20 GHICHU c) Tên Quyền Ghi Chú Text 80 Các ràng buộc toàn vẹn (RB1) MAGY...
Ngày tải lên: 09/08/2014, 08:20
Characterization of fetomaternal microchimerism in a murine model 1
... Goat 1: 100 Anti-goat Alexa 594 1: 250 Rat 1: 150 Anti-rat Alexa 594 1: 300 Rat 1: 50 Anti-rat Alexa 594 1: 100 Mouse 1: 333 Anti-mouse Alexa 594 1: 500 Rabbit 1: 500 Anti-rabbit Alexa 594 1: 750 31 2.5 ... 19 (Abcam) CD1 41 (R&D System) CD 31 (BD Pharmingen) CD45 (BD Pharmingen) MAP2 (Chemicon) Ki67 (Millipore) Rabbit 1: 50 Secondary Antibody Anti-rabbit Flourophore Dilution Alexa 647 1: 100 Goat 1: 100 ... gtaggtggaaattctagcatcatcc Cre -10 84 /10 85 gcggtctggcagtaaaaactatc gtgaaacagcattgctgtcactt Meox2 -15 42 gggaccaccttcttttggcttc Meox2 -18 71 aagatgtggagagttcggcctag Meox2-36 71 ccagatcctcctcagaaatcagc eGFP-0872 /14 16 aagttcatctgcaccaccg...
Ngày tải lên: 09/09/2015, 18:49
Modifiers of inflammatory angiogenesis in a murine model 1
... formation 11 III Abnormal wound healing 12 1. 3 Cytokines in angiogenesis and wound healing 1. 3 .1 Chemokines in angiogenesis and wound healing 14 14 ii 1. 3.2 TNF-α: proinflammatory cytokine 18 1. 3.3 ... MIP-2, MCP -1, TNF-α, and TGF- 1 120 IX Effects of neutrophil depletion on scar formation 12 7 Chapter IV DISCUSSION 12 9 4 .1 Introduction of animal models used in the current study 12 9 4 .1. 1 To study ... neutrophils 13 1 13 2 13 3 13 3 4.3.2 Key rolel of neurophils in angiogenesis in the corneal and skin injury model 13 5 4.3.3 Important roles of neutrophil in wound healing in a skin injury model 14 1 4.4...
Ngày tải lên: 11/09/2015, 10:03
Development of cell sheet constructs for layer by layer tissue engineering using the blood vessel as an experimental model 1
... .1 1 .1 Tissue Engineering as a Solution to Organ Shortage 1. 1 .1 Classical Tissue Engineering .3 1. 1 .1. 1 Early success in skin and osteoarticular tissue 1. 1 .1. 2 Recent ... tube forming assay 85 2 .1. 11 Umbilical Cord Perivascular Cells (UCPVC) 85 2 .1. 11. 1 Isolation 85 2 .1. 11. 2 Immunocytochemistry .86 2 .1. 11. 3 Serum starvation ... 11 1. 1.3 .1 1.2 Microthin films for use in layer-by-layer tissue engineering 12 Vascular Tissue Engineering .13 1. 2 .1 Clinical Need For Vascular Tissue Engineering 14 1. 2.2...
Ngày tải lên: 14/09/2015, 08:49
1 TOEFL WRITING (TWE) TOPICS AND MODEL ESSAYS
... today? Choose one skill and use specific reasons and examples to support your choice 11 TWE Essays 12 /292 41 Some people think that human needs for farmland, housing, and industry are more important ... answer 13 TWE Essays 14 /292 12 Many people visit museums when they travel to new places Why you think people visit museums? Use specific reasons and examples to support your answer 11 Do you agree ... details to explain your choice 16 4 16 4 People many different things to stay healthy What you for good health? Use specific reasons and examples to support your answer 16 3 Is the ability to read and...
Ngày tải lên: 18/03/2013, 01:44
Exergoeconomic performance optimization of an endoreversible intercooled regenerated Brayton cogeneration plant Part 1: Thermodynamic model and parameter analyses
... J., 19 96, 21( 12): 11 27 -11 34 [36] Chen L, Sun F, Chen W Finite time exergoeconomic performance bound and optimization criteria for two-heat-reservoir refrigerators Chin Sci Bull., 19 91, 36(2): 15 6 -15 7 ... TK [ xc2 c3TH (1 − ER ) − xy (T1 − ELTL − c3 EK TK ) + c2 c3 y ER ( xc5T1 + EI TI )] − xc4 Cwf (1 − ER )[c2 ELTK (T1 − TL ) + c2 c3 EI TK ( xT1 − TI )] − xc4 Cwf EK TK (1 − ER )(T1 − ELTL − c3TK ... calculations, k = 1. 4 , Cwf = 1. 0kW / K , τ = τ = and τ = 1. 2 are set According to analysis in Ref [46], a = 10 and b = are set 4 .1 The total pressure ratio is fixed Assuming that π = 18 (1 < π ≤ 18 ) The...
Ngày tải lên: 05/09/2013, 14:58
Tài liệu Activity 5.1: Identifying Keys in the Logical Model pdf
... EndDate Description ∞ ∞ Vehicle Make Model VIN Year Is Issued BeginMileage EndMileage MaintenanceCost1 MaintenanceDesc1 MaintenanceDate1 MaintenanceMiles1 MaintenanceCost2 MaintenanceDesc2 MaintenanceDate2 ... 22 Activity 5 .1: Identifying Keys in the Logical Model Exercise 1: Identifying Keys In this exercise, you will identify primary, foreign, and composite keys for a logical data model based on ... Primary or Foreign Next, you will discuss your answers with the class Activity 5 .1: Identifying Keys in the Logical Model 23 Contract Contracts With ∞ Employee Timesheet Name Address SSN E-Mail...
Ngày tải lên: 21/12/2013, 06:16
Tài liệu Chương 1 - Giới thiệu chung các model docx
... 3G3JV-A20 01 (0 .1 kW), 3G3JV-A2002 (0.25 kW), 3G3JV-A2004 (0.55 kW), 3G3JVA2007 (1. 1 kW) 3G3JV-AB0 01 (0 .1 kW), 3G3JV-AB002 (0.25 kW), 3G3JV-AB004 (0.55 kW) 3G3JV - Chương - Giới thiệu chung 1- 3 Bộ ... 3G3JV - Chương - Giới thiệu chung 1- 2 Triệt tiêu sóng hài - Có thể nối với cuộn kháng DC vốn hiệu cuộn kháng AC thông thường.; có thẻ kết hợp hai để tăng hiệu 1- 2 Ký hiệu Trên mặt Nắp bảo vệ Lỗ ... Đèn báo dòng Dòng điện biến tần IOUT theo dõi đèn sáng Đèn báo MNTR Các giá trị đặt thông số U 01 đến U10 theo dõi đèn sáng Đèn báo chiều Có thể lựa chọn chiều quay quay thuận nghịch đèn sáng thao...
Ngày tải lên: 20/01/2014, 06:20
Tài liệu Báo cáo khoa học: Cleavage of nonphenolic b-1 diarylpropane lignin model dimers by manganese peroxidase from Phanerochaete chrysosporium Evidence for a hydrogen abstraction mechanism docx
... LiP – no reaction III IV V 14 21 21 58 VII VIII 1. 5 12 14 .4 11 .5 61 22 32 3.5 13 t 1. 2 X XI X 11 .2 9.7 t 4.4 6.7 3.5 5.0 a MnP reactions were conducted at 28 °C for 15 h in 50 mM malonate, pH ... A.N., Jensen, K.A & Hammel, K.E (19 99) Peroxyl radicals are potential agents of lignin biodegradation FEBS Lett 4 61, 11 5 11 9 ´ ´ 31 Perie, F.H & Gold, M.H (19 91) Manganese regulation of manganese ... Phanerochaete chrysosporium Arch Microbiol 12 9, 14 1 14 5 35 Enoki, A & Gold, M.H (19 82) Degradation of the diarylpropane lignin model compound 1- (3,4-diethoxyphenyl) -1, 3-dihydroxy-2(4-methoxyphenyl)-propane...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: A Caenorhabditis elegans model of orotic aciduria reveals enlarged lysosome-related organelles in embryos lacking umps-1 function potx
... umps -1( zu456); wht-2(RNAi)f umps -1( zu456); pyr -1( RNAi)f umps -1( RNAi); pyr -1( cu8)f umps -1( zu456); pyr -1( cu8)m umps -1( zu456); R12E2 .11 (RNAi)f Mosaic RNAi rrf -1( pk14 71) n rrf -1( pk14 71) ; umps -1( RNAi) ... alx -1( gk275), apt-6(ok429), glo -1( zu437), mrp-4(ok1095), pgp-2(kx55), ppk-3(n2668), ppk-3(ok 115 0), ppk-3(zu443), rab -10 (dx2), rde -1( ne 219 ), rme -1( b1045), rrf -1( pk14 71) , rrf-3(pk1426), tat -1( kr15), ... unc -11 9(+)] [32], mIs 11[ myo-2::gfp], OLB 11 dusIs [elt-2p::rde -1( +)] [42], pwIs50[lmp -1: :gfp; unc -11 9(+)] [35], pwIs72[vha-6p::rab5::gfp; unc -11 9(+)] [13 ], pwIs170[vha-6p::rab-7::gfp; unc 119 (+)]...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx
... 10 0 2.08 13 7 329 10 0 2 .1 98 12 4 10 0 2.6 59,023 38 446 99.8 0.063 (0 .14 9)b 17 .4 (12 .9)b C2 28 14 0 99.9 0.064 (0 .19 5)b 9.7 (3.6)b P 21 19,275 96.8 0.078 (0 .12 2)b 7.4 (5.4)b C2 12 1.5 50.4 10 7.8 10 4.3 ... (99.2)a 0 .15 4 (0 .15 5)a 0 .18 7 (0. 211 )a 0.005 1. 3 33–2.6 28 12 0 99.7 (99.5)a 0 .15 6 (0 .19 4)a 0.200 (0.254)a 0.006 1. 3 35–2.6 19 ,275 96.7 (84 .1) a 0 .15 0 (0 .18 3)a 0 .19 0 (0.264)a 0.006 1. 3 5038 12 5 452 ... 78 383 5038 225 474 11 .9 42.3 21. 5 16 .4 37.7 25.6 13 .9 54.5 19 .4 ˚ ˚ The values for the highest resolution shell are given in parentheses (2. 21 2.08 A for D356N/P2, 2.23–2 .10 A for D356N/E396Q/P2,...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: A steady-state competition model describes the modulating effects of thrombomodulin on thrombin inhibition by plasminogen activator inhibitor-1 in the absence and presence of vitronectin ppt
... PAI -1 alone (ki 10 5 M )1 s )1) Therefore, the inhibitory effect of TM on the inhibition of 15 nM thrombin by preincubated PAI -1/ VN complexes (10 0 nM PAI and 15 0 nM VN) was determined (Fig 1D) ... Arterioscler Thromb Vasc Biol 18 , 18 61 18 69 Ó FEBS 2003 Thrombomodulin sterically blocks the thrombin/PAI -1 interaction (Eur J Biochem 270) 19 51 15 Rezaie, A.R (19 99) Role of exosites and in ... & Pannekoek, H (19 91) Thrombin neutralizes plasminogen activator inhibitor (PAI -1) that is complexed with vitronectin in the endothelial cell matrix J Cell Biol 11 5, 17 73 17 81 Horrevoets, A.J.G.,...
Ngày tải lên: 23/03/2014, 17:21
CERT® Resilience Management Model, Version 1.0 pptx
... CERT-RMM 1. 3 CERT-RMM 1. 4 CERT-RMM and CMMI Models 1. 5 Why CERT-RMM Is Not a Capability Maturity Model 10 12 Understanding Key Concepts in CERT-RMM 2 .1 Foundational Concepts 15 15 2.2 15 17 18 19 2.3 ... Scheme Typographical and Structural Conventions Model Relationships 4 .1 The Model View 4 .1. 1 Enterprise Management i | CMU/SEI-2 010 -TR- 012 36 37 38 41 41 42 4.2 Objective Views for Assets 46 Part ... CMU/SEI-2 010 -TR- 012 List of Tables Table 1: Process Areas in CERT-RMM and CMMI Models 11 Table 2: Other Connections Between CERT-RMM and the CMMI Models 12 Table 3: Process Areas by Category 31 Table...
Ngày tải lên: 23/03/2014, 23:21
Báo cáo khoa học: Tumor suppressor p16INK4a: Downregulation of galectin-3, an endogenous competitor of the pro-anoikis effector galectin-1, in a pancreatic carcinoma model pptx
... affects Gal-3 mRNA availability 10 0 10 0 0 10 0 C 10 1 10 2 10 3 10 4 10 0 10 1 10 2 10 3 10 4 Fig p16INK4a restitution inhibits Gal-3 expression (A) Western blot after 1D SDS ⁄ PAGE [15 % gel, proteins blotted ... Sanchez-Ruderisch et al G -1 + G al G 80 C 40 Counts 12 0 B 10 0 10 1 10 2 Gal-3 binding (log fluorescence) 80 40 Counts 12 0 C 10 0 10 1 10 2 Gal -1 binding (log fluorescence) Fig Gal-3 inhibits Gal -1- stimulated anoikis ... 600 12 20 40 60 80 0 600 200 400 FL2-H 600 30 60 90 12 0 0 200 400 FL2-H 600 12 40 80 12 0 16 0 400 FL2-H 200 200 400 FL2-H 16 600 200 400 FL2-H 600 31 10 20 30 40 50 60 0 Counts p16-3 0 40 80 12 016 0...
Ngày tải lên: 29/03/2014, 21:20