motion of ship b relative to ship a

Tài liệu A Collection of State-Papers, Relative to the First Acknowledgment doc

Tài liệu A Collection of State-Papers, Relative to the First Acknowledgment doc

... see and feel every day. A native of < /b> America who cannot read and write, is as rare an appearance as a Jacobite, or a Roman Catholic, i e as rare as a comet or an earthquake. It has been observed, ... excellency Mr Adams, on drinking to him out of < /b> a large beautiful glass, which is called a baccale, and had inscribed round its brim, Aurea Libertas: AUREA LIBERTAS! gaude! pars altera mundi Vindice ... Atlantic are so high, and the price of < /b> labour in America so dear, that tar, pitch, turpentine, and ship-< /b> timber never can be transported to Europe at so cheap a rate, as it has been and will be...

Ngày tải lên: 20/02/2014, 08:20

49 552 0
Tài liệu Báo cáo Y học: The binding of lamin B receptor to chromatin is regulated by phosphorylation in the RS region ppt

Tài liệu Báo cáo Y học: The binding of lamin B receptor to chromatin is regulated by phosphorylation in the RS region ppt

... extract and a binding assay involving sperm chromatin and beads bearing LBR fragments The binding was stimulated by preincubation of < /b> beads bearing LBR fragments with a synthetic phase extract, ... addition of < /b> M NaCl to the washing buffer to remove possible bound proteins from gel beads had no effect on the binding of < /b> chromatin to beads Expression of < /b> LBR fragments and preparation of < /b> beads bearing ... examined and it was found that 60 is necessary to reach a plateau of < /b> increased binding affinity (Fig 4A) The same preincubation time was applicable to experiments involving a mitotic phase cytosol...

Ngày tải lên: 22/02/2014, 04:20

11 563 0
Báo cáo hóa học: "Research Article ISAR Imaging of Ship Target with Complex Motion Based on New Approach of Parameters Estimation for Polynomial Phase Signal" docx

Báo cáo hóa học: "Research Article ISAR Imaging of Ship Target with Complex Motion Based on New Approach of Parameters Estimation for Polynomial Phase Signal" docx

... It can be seen from (5) that the received signal in a range bin can be modeled as multicomponent CPS for ISAR imaging of < /b> ship < /b> target with high maneuverability In this paper, a new algorithm called ... signal in a range bin where qr , q p , and q y are the angular amplitudes in radians and ωr , ω p , and ω y are the roll, pitch, and yaw angular velocities, respectively The rotation parameters of < /b> ... complicated, and this demonstrates that the ship < /b> target has high maneuverability Figure is the ISAR image based on the RD algorithm For the high maneuverability of < /b> the target, the image is blurred...

Ngày tải lên: 21/06/2014, 05:20

9 412 0
Nonlinear model simulation of ship motion

Nonlinear model simulation of ship motion

... am p litu d e o f vertical m otion , the am plitude of < /b> angular ship < /b> vibration (a) decreases, and at a constant value of < /b> the excitation frequency (77) the am plitudes of < /b> vertical and angular ship < /b> ... ip vibration is a lw a y s accom p an ied by angular m otion T he stationary' sim ultaneous v ertical and angular m o tio n s o f th e ship < /b> have been studied too REFERENCES Tondl A , N a b erg ... of < /b> a ship < /b> running in a regular lo n g itu d in a l or ob liq u e sea has been studied by T ondl A and Nabergoj R | l | T he proposed m o d el c o n s ists o f a m ass M restrained by a linear...

Ngày tải lên: 08/04/2015, 15:29

7 179 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... temperature PhyH was stable at neutral and alkaline pH; PhyH-DII was less stable under the same conditions (Fig 2D) PhyH was basically stable at 35 °C, and retained 60% of < /b> the initial activity at 45 °C ... sum of < /b> PhyH-DI and PhyH-DII and two times greater than that of < /b> PhyHDII This large variance cannot be ascribed to the function of < /b> PhyH-DI alone The dual-domain phytase was shown to be a dimer according ... method according to Huang et al [10] Catalysis of < /b> a dual-domain b- propeller phytase Nucleotide sequence assembly was performed using Vector NTI Advance 10.0 software (Invitrogen, Carlsbad, CA, USA),...

Ngày tải lên: 14/02/2014, 15:20

9 802 0
Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

... into the nonprimed Table Average distances between CA atoms of < /b> the stefins and catalytic residues of < /b> cysteine proteases Distance calculated ˚ d (A) Papain–stefin B Cathepsin H–stefin A Cathepsin B stefin ... loop is fastened to the cathepsin B surface by the hydrogen bond between the stefin A A49 amide and cathepsin B G24 carbonyl The binding of < /b> this loop is further stabilized by a hydrogen bond between ... Turk B, Turk V, Karaoglanovic-Carmona A, Juliano L & Turk D (2000) Crystal structure of < /b> cathepsin X: a flip-flop of < /b> the ring of < /b> His23 allows carboxy-monopeptidase and carboxy-dipeptidase activity of...

Ngày tải lên: 18/02/2014, 04:20

8 633 0
Tài liệu Báo cáo khoa học: Three-dimensional structures of thermophilic b-1,4-xylanases from Chaetomium thermophilum and Nonomuraea flexuosa Comparison of twelve xylanases in relation to their thermal stability pdf

Tài liệu Báo cáo khoa học: Three-dimensional structures of thermophilic b-1,4-xylanases from Chaetomium thermophilum and Nonomuraea flexuosa Comparison of twelve xylanases in relation to their thermal stability pdf

... hydrogen bonding with b- strand A5 and the extension of < /b> b- strand B3 interacts with a b- strand B4 BAX also has a longer C-terminal b- strand A4 and a short additional b- strand after that When the ... attached (Fig 2B) Carbohydrates are orientated in the same way as the backbone of < /b> b- strand B1 and therefore they are almost like an extension of < /b> the b- strand N-glycans are known to have a stabilizing ... & Matsuzawa, H (1998) Crystallographic and mutational analyses of < /b> an extremely acidophilic and acid-stable xylanase: Biased distribution of < /b> acidic residues and importance of < /b> Asp37 for catalysis...

Ngày tải lên: 20/02/2014, 23:20

14 520 0
Relative risk of surface water pollution by E. coli derived from faeces of grazing animals compared to slurry application pptx

Relative risk of surface water pollution by E. coli derived from faeces of grazing animals compared to slurry application pptx

... Tian et al 2002) At a farm scale, important factors include the relative size of < /b> FIO inputs to land from grazing animals and from slurry stores, and relative timing of < /b> slurry and fresh faecal ... the grazed paddocks, one of < /b> the lambs had to be removed because of < /b> sickness shortly after the start of < /b> the experiment Faecal samples from of < /b> the lambs were taken on one occasion and the total E ... June to 31 July 2002 and total numbers of < /b> faecal coliforms and streptococci were determined The instantaneous ¯ow rate on each drain was measured at the time of < /b> sampling with a bucket and stopwatch...

Ngày tải lên: 15/03/2014, 23:20

10 445 0
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

... GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC ... GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC GCAATACTCAGAGCCTTGGCGTCAGGCTCCAGAGC ... Ala a- DGwt ⁄ b- DGPhe718 fi Ala a- DGwt ⁄ b- DGPhe692 fi Ala ⁄ Phe718 fi Ala a- DGwt ⁄ b- DGPhe692 fi Ala ⁄ Phe700 fi Ala ⁄ Phe718 fi Ala a- DGTrp551 fi Ala ⁄ b- DGwt a- DGPhe554–Ala ⁄ b- DGwt a- DGAsn555 fi Ala...

Ngày tải lên: 16/03/2014, 12:20

15 337 0
Báo cáo khoa học: Existence of novel b-1,2 linkage-containing side chain in the mannan of Candida lusitaniae, antigenically related to Candida albicans serotype A potx

Báo cáo khoa học: Existence of novel b-1,2 linkage-containing side chain in the mannan of Candida lusitaniae, antigenically related to Candida albicans serotype A potx

... Manb1fi2Manb1fi2Manb1fi2Mana1fi2 Manb1fi2Manb1fi2Manb1fi2Mana1fi2 Manb1fi2Manb1fi2Mana1fi2 Manb1fi2Manb1fi2Mana1fi3 Manb1fi2Manb1fi2Mana1fi2(3) Manb1fi2Mana1fi2 Manb1fi2Mana1fi3 Mana1fi6 Manb1fi2Manb1fi2Mana1fiphosphate Manb1fi2Manb1fi2Mana1fiphosphate ... a1 fi6Mana1fi6Mana1fi6Mana1fi6 ›2 ›2 ›2 a1 fi2Mana1 Mana1fi2 Mana1fi6 a1 fi6Mana1fi6 a1 fi3Mana1fi2 Manb1fi2Mana1fi3 Manb1fi2Manb1fi2Mana1fi3 Manb1fi2Mana1fi2 Manb1fi2Manb1fi2Mana1fi2 Manb1fi2Manb1fi2Manb1fi2Mana1fi2 Manb1fi2Manb1fi2Manb1fi2Mana1fi2 ... Manb1fi2Mana1fi 2Mana1fi2Mana1fi2Man; d, Manb1fi2Manb1fi2Mana1fi2Man a1 fi2Mana1fi2Man; n, Manb1fi2Mana1fi3Mana1fi2Mana1fi 2Man; m, Manb1fi2Manb1fi2Mana1fi3Mana1fi2Mana1fi 2Man Because we could assign cross-peaks...

Ngày tải lên: 17/03/2014, 03:20

11 456 0
Review and Evaluation of Proposed Legislation Entitled: An Act Relative to Women’s Health and Cancer Recovery Senate Bill 896 pdf

Review and Evaluation of Proposed Legislation Entitled: An Act Relative to Women’s Health and Cancer Recovery Senate Bill 896 pdf

... Health Parity Act of < /b> 2000, as amended by Chapter 256 of < /b> the Acts of < /b> 2008, An Act Relative to Mental Health Benefits The federal Mental Health Parity Act of < /b> 1996 and the Mental Health Parity and Addiction ... 23  TOC This report was prepared by Lars Loren, JD, James Highland, PhD, MHSA, Lisa Manderson, ASA, MAAA, and Joshua Roberts Actuarial Assessment of < /b> Senate Bill 896: An Act Relative to Women’s ... hospital stay, so the mandated coverage of < /b> hospital stays is unlikely to affect care for lumpectomy Advantages and disadvantages of < /b> hospital stays and in particular for patients undergoing mastectomy...

Ngày tải lên: 22/03/2014, 10:20

63 339 0
Báo cáo khoa học: The relative contribution of mannose salvage pathways to glycosylation in PMI-deficient mouse embryonic fibroblast cells pdf

Báo cáo khoa học: The relative contribution of mannose salvage pathways to glycosylation in PMI-deficient mouse embryonic fibroblast cells pdf

... or bafilomycin A1 , and glycosylation analysis was performed Swainsonine is an indolizidine alkaloid that acts as a reversible inhibitor of < /b> lysosomal a- mannosidase and of < /b> the Golgi complex a- mannosidase ... with rabbit anti-DNase I serum and protein A agarose beads, and the eluant was subjected to SDS ⁄ PAGE In the first panel, lane is intact immunoprecipitated protein, and lanes and are endo -b- N-acetylglucosaminidase-treated ... glycosylation can come from membrane traffic-independent salvage pathways Studies are underway to clearly define the relative contributions of < /b> these mannose salvage pathways Intracellular mannose salvage...

Ngày tải lên: 30/03/2014, 04:20

11 428 0
QUI TRÌNH THIẾT KẾ TÀU TỰ ĐỘNG* AUTOMATIC PROCESS OF SHIP DESIGN

QUI TRÌNH THIẾT KẾ TÀU TỰ ĐỘNG* AUTOMATIC PROCESS OF SHIP DESIGN

... Sống boong Sống phụ boong Vùng khoang lái Đà ngang đáy Sống đáy Sườn thường Sườn khoẻ Sống dọc mạn Xà ngang boong thường Xà ngang boong khoẻ Sống boong Sống phụ boong Vùng buồng máy Đà ngang b ... cong Pantokaren Cân dọc ổn định ban đầu Hình 1: Hydrostatic Curves Kết tóm lược b ng B ng Cân dọc tàu TT 4 Hạng mục tính tóan Thể tích ngâm nước Chiều chìm trung b nh Chiều dài tương ứng Hòanh ... Sống dọc mạn Xà ngang boong thường Xà ngang boong khoẻ Sống boong Sống phụ boong Vùng mũi Đà ngang đáy Sống đáy Sườn thường Sườn khoẻ Sống dọc mạn Xà ngang boong thường Xà ngang boong khoẻ QUY CÁCH...

Ngày tải lên: 24/05/2014, 19:08

6 448 0
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx

Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx

... Dogan A, Flanagan A, Teague J, Futreal PA, Stratton MR, Wooster R: The COSMIC (Catalogue of < /b> Somatic Mutations in Cancer) database and website Br J Cancer 2004, 91:355-358 20 Mitelman Database of < /b> ... Nishioka C, Tasaka T, Taniguchi A, Kuwayama Y, Komatsu N, Bandobashi K, Togitani K, Koeffler HP, et al: AZD1152, a novel and selective aurora B kinase inhibitor, induces growth arrest, apoptosis, and ... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of < /b> candidate anticancer agents Nat Rev Cancer...

Ngày tải lên: 18/06/2014, 22:20

10 618 0
báo cáo hóa học: " The evolution of methods for the capture of human movement leading to markerless motion capture for biomechanical applications" pptx

báo cáo hóa học: " The evolution of methods for the capture of human movement leading to markerless motion capture for biomechanical applications" pptx

... subsequently tracked auto- (a) Selected background images (top) and separated subject data (bottom) Figure (a) Selected background images (top) and separated subject data (bottom) (b) Camera configuration, ... disease severity in medial tibiofemoral osteoarthritis Arthritis and Rheumatism 1998, 41(7):1233-1240 Miyazaki T, Wada M, Kawahara H, Sato M, Baba H, Shimada S: Dynamic load at baseline can predict ... 1997:568-574 Yamamoto M, Koshikawa K: Human motion < /b> analysis based on a robot arm model Computer Vision and Pattern Recognition 1991 Bharatkumar AG, Daigle KE, Pandy MG, Cai Q, Aggarwal JK: Lower limb kinematics...

Ngày tải lên: 19/06/2014, 10:20

11 511 0
Báo cáo hóa học: " Elective caesarean section versus vaginal delivery for preventing mother to child transmission of hepatitis B virus – a systematic review" pot

Báo cáo hóa học: " Elective caesarean section versus vaginal delivery for preventing mother to child transmission of hepatitis B virus – a systematic review" pot

... risk of < /b> bias (graded C) According to the quality criteria listed above, we considered each included study was at high risk of < /b> bias and graded as category C Assessment of < /b> publication bias There was ... or cesarean section after onset of < /b> labor or after rupture of < /b> membranes) It is well known that, in the absence of < /b> HBV infection, ECS is related to increased risks of < /b> maternal and infant morbidity ... umbilical blood or peripheral blood after birth Secondary outcomes (morbidities related to the actual method of < /b> delivery) 14 NEONATAL MORBIDITY 15 MATERNAL MORTALITY 16 MATERNAL MORBIDITY (1)Maternal...

Ngày tải lên: 20/06/2014, 01:20

7 339 0
Báo cáo hóa học: " Application of real-time PCR to quantify hepatitis B virus DNA in chronic carriers in The Gambia" pptx

Báo cáo hóa học: " Application of real-time PCR to quantify hepatitis B virus DNA in chronic carriers in The Gambia" pptx

... volunteering to participate Thanks to Adam Jeng-Barry and Alasana Bah for laboratory assistance, Joseph Bass, Yusupha Bah, Lamin Giana and Mansour Nyang for field assistance We would like to thank Adrian ... direct comparison to the International HBV DNA standard Data management The data obtained in the ABi real time machine after the PCR amplification and quantification of < /b> DNA was exported as an Excel ... hepatitis B: a randomised trial Lancet 2005, 365:123-129 Barbaro G, Zechini F, Pellicelli AM, Francavilla R, Scotto G, Bacca D, Bruno M, Babudieri S, Annese M, Matarazzo F, Di Stefano G, Barbarini...

Ngày tải lên: 20/06/2014, 01:20

7 430 0
w