mfv as a stem cell virus

báo cáo khoa học:" Fanconi anemia manifesting as a squamous cell carcinoma of the hard palate: a case report" pptx

báo cáo khoa học:" Fanconi anemia manifesting as a squamous cell carcinoma of the hard palate: a case report" pptx

... surface was erythematous and smooth, with some telangiectasias Clinical examination showed no regional lymphadenopathy CT and MR imaging showed a hard and soft tissue mass extending from molar region ... mucosa to the soft palate mucosa The nasopharynx appeared normal (Figure 2) No significant cervical lymphadenopathy was seen on the images An incisional biopsy performed under local anaesthesia ... B, Yalcin S: Squamous cell carcinoma of the tongue in a patient with Fanconi's anemia: a case report and review of the literature Ann Hematol 2002, 81:294-298 Kutler DI, Auerbach AD, Satagopan...

Ngày tải lên: 11/08/2014, 23:22

5 245 0
Báo cáo y học: "Bovine herpesvirus 4 based vector as a potential oncolytic-virus for treatment of glioma" pps

Báo cáo y học: "Bovine herpesvirus 4 based vector as a potential oncolytic-virus for treatment of glioma" pps

... counted from each slide, and the percentage of apoptotic and necrotic cells was calculated At least control and treated slides were counted for each treatment Monovariate ANOVA was used to test ... research 2005, 65(20):9463-9472 Yamamoto Y, Murakami K, Inoshima Y, Nakane T, Saika K, Sentsui H: Characterization of a bovine herpesvirus type isolated from the spinal cord of a cow with astasia ... Fondazione Cariparma (Cassa di Risparmio di Parma, Italy) for funding contributions to the project Author details Department of Human Anatomy and Physiology, University of Padova, Italy Department of...

Ngày tải lên: 12/08/2014, 02:20

6 232 0
báo cáo khoa học: "The transplant iron score as a predictor of stem cell transplant survival" pptx

báo cáo khoa học: "The transplant iron score as a predictor of stem cell transplant survival" pptx

... lysozyme, alpha-1 antitrypsin and other acute phase proteins Values for aspartate transaminase (AST), alanine transaminase (ALT), total bilirubin (TB), and the international normalized ratio (INR) ... represents a or AML indicates acute myeloid leukemia; ALL, acute lymphoblastic leukemia; MDS myelodysplastic syndrome; AA, aplastic anemia plant echocardiogram or MUGA scan All measures of EF ... by the Transplant Iron Score Based on these groupings, a univariate relative risk of death was calculated for each iron parameter using hazard regression analysis Survival time was measured from...

Ngày tải lên: 10/08/2014, 22:20

9 320 0
Báo cáo khoa học: " Challenging complications of treatment – human herpes virus 6 encephalitis and pneumonitis in a patient undergoing autologous stem cell transplantation for relapsed Hodgkin''''s disease: a case report" doc

Báo cáo khoa học: " Challenging complications of treatment – human herpes virus 6 encephalitis and pneumonitis in a patient undergoing autologous stem cell transplantation for relapsed Hodgkin''''s disease: a case report" doc

... lavage Diagn Microbiol Infect Dis 2005, 52:275-280 Fujimaki K, Mori T, Kida A, Tanaka M, Kawai N, Matsushima T, Kishi K, Fujisawa S, Sakura T, Yokota A, Kanda Y, Taguchi J, Akiyama H, Kanamori ... reviewed and published immediately upon acceptance Ogata M, Kikuchi H, Satou T, Kawano R, Ikewaki J, Kohno K, Kashima K, Ohtsuka E, Kadota J: Human herpesvirus DNA in plasma after allogeneic stem cell ... Marty FM, Schwartz RB: MR imaging of human herpesvirus-6-associated encephalitis in patients with anterograde amnesia after allogeneic hematopoietic stem- cell transplantation AJNR Am J Neuroradiol...

Ngày tải lên: 12/08/2014, 04:21

3 366 0
Báo cáo khoa học: " Challenging complications of treatment – human herpes virus 6 encephalitis and pneumonitis in a patient undergoing autologous stem cell transplantation for relapsed Hodgkin''''s disease: a case report" ppsx

Báo cáo khoa học: " Challenging complications of treatment – human herpes virus 6 encephalitis and pneumonitis in a patient undergoing autologous stem cell transplantation for relapsed Hodgkin''''s disease: a case report" ppsx

... lavage Diagn Microbiol Infect Dis 2005, 52:275-280 Fujimaki K, Mori T, Kida A, Tanaka M, Kawai N, Matsushima T, Kishi K, Fujisawa S, Sakura T, Yokota A, Kanda Y, Taguchi J, Akiyama H, Kanamori ... reviewed and published immediately upon acceptance Ogata M, Kikuchi H, Satou T, Kawano R, Ikewaki J, Kohno K, Kashima K, Ohtsuka E, Kadota J: Human herpesvirus DNA in plasma after allogeneic stem cell ... Marty FM, Schwartz RB: MR imaging of human herpesvirus-6-associated encephalitis in patients with anterograde amnesia after allogeneic hematopoietic stem- cell transplantation AJNR Am J Neuroradiol...

Ngày tải lên: 12/08/2014, 04:22

3 303 2
Báo cáo y học: "Ku protein as a potential human T-cell leukemia virus type 1 (HTLV-1) Tax target in clastogenic chromosomal instability of mammalian cells" ppt

Báo cáo y học: "Ku protein as a potential human T-cell leukemia virus type 1 (HTLV-1) Tax target in clastogenic chromosomal instability of mammalian cells" ppt

... gastric and colorectal carcinoma, breast tumours and adrenal tumours [6,7], and in some pre-neoplastic growths [8] It is generally assumed that telomerase is silent in most primary somatic cells ... rearrangements/ damages Provocatively, such gross rearrangements/damages can, at a low frequency, fortuitously alter the genome in a way to actually induce telomerase activity in the genetically ... these factors and could lead to increased DNA structural instability and progression of damage Progression of DNA structural damage may ultimately contribute to and mechanistically explain the...

Ngày tải lên: 13/08/2014, 09:21

10 356 0
Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy

Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy

... Laboratories, PA, USA) The following primers were used: HSVtk, 5'-CCCATATCGGGGACACGTTATTT3' (forward) and 5'-GATAAAGACGTGCATGGAACGGAG-3' 5'-CCTGGATGCCGAACAAGGTTTA-3' (forward) CCAGCGTTCAATGCCTTCAAAC-3' TGGTGTTCCTATTGGCGGATGTCT ... GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA -3’ (reverse), size:1.2kb; Fcy 5’-AGGAATTCATGGTGACAGGGGGAATG -3’ (forward) and 5’- CCGCTCGAGCTACTCACCAATATCTTCA -3’ (reverse), ... DA, 2005) As compared to adenovirus and AAV, baculovirus is an insect virus and humans not appear to possess pre-existing antibody and T -cell specifically against baculovirus Baculovirus does...

Ngày tải lên: 09/09/2015, 18:56

134 439 0
Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones

Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones

... 0) and condensation ( m phase < 0) is assumed Where m phase is mass transfer: for evaporation & & & & ( m phase = mevap ) and for condensation ( m phase = mcond ) (kg/s) So that the mass balance ... field, mass transport and electrochemistry in an air-breathing cathode of a planar PEM fuel cell In their results, electrochemical/mass characteristics such as flow velocities, species mass fraction, ... However, these fuel cell designs have generally relied on traditional planar MEA architecture Because the majority of PEM fuel cell designs are based on planar plate and frame architecture, their...

Ngày tải lên: 05/09/2013, 14:58

18 549 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

... kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a ... Immediately after treatment, the cells were cooled to °C and lysed Luciferase activity was measured as described in [48] Statistical analysis All data are expressed as mean ± SD Student’s paired ... times a week Membrane fluidity measurements The plasma membrane fraction of K562 cells was isolated according to Maeda et al [44] Isolated plasma membranes were labeled in 10 mm Tris, 10 mm NaCl...

Ngày tải lên: 07/03/2014, 12:20

10 452 0
Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx

... with advanced non-small -cell lung, breast, colon, and pancreatic cancer J Clin Oncol 22, 4456–4462 Solit DB, Garraway LA, Pratilas CA, Sawai A, Getz G, Basso A, Ye Q, Lobo JM, She Y, Osman I et al ... a potent inhibitor of mitogen-activated protein kinase ⁄ extracellular signal-regulated kinase kinase ⁄ kinases: mechanism of action in vivo, pharmacokinetic ⁄ pharmacodynamic relationship, and ... leukaemia cells through a Bim dependent pathway modulated by cytokines Cancer Biol Ther 6, 912–919 66 Kuroda J, Kimura S, Strasser A, Andreef A, O’Reilly LA, Ashihara E, Kamitsuji Y, Yokota A, Kawata...

Ngày tải lên: 16/03/2014, 00:20

13 453 0
Báo cáo khoa học: RIP1 comes back to life as a cell death regulator in TNFR1 signaling docx

Báo cáo khoa học: RIP1 comes back to life as a cell death regulator in TNFR1 signaling docx

... early after receptor ligation whereas the cell death regulators FAS-associated via death domain (FADD) and caspase are recruited to a pro-apoptotic complex that forms slowly in the cytoplasm This ... regulatory factor signaling pathways Nat Immunol 8, 592–600 73 Ashida H, Kim M, Schmidt-Supprian M, Ma A, Ogawa M & Sasakawa C (2010) A bacterial E3 ubiquitin ligase IpaH9.8 targets NEMO ⁄ IKKgamma ... of caspases increases the sensitivity of L929 cells to necrosis mediated by tumor necrosis factor J Exp Med 187, 1477–1485 62 Sasazuki T, Okazaki T, Tada K, Sakon-Komazawa S, Katano M, Tanaka M,...

Ngày tải lên: 28/03/2014, 23:20

11 503 0
báo cáo hóa học:" Combined intermittent hypoxia and surface muscle electrostimulation as a method to increase peripheral blood progenitor cell concentration" pot

báo cáo hóa học:" Combined intermittent hypoxia and surface muscle electrostimulation as a method to increase peripheral blood progenitor cell concentration" pot

... and/or assembly of data, data analysis and interpretation, manuscript writing; RS: data analysis and interpretation, manuscript writing All authors read and approved the final manuscript Additional ... and/or assembly of data, data analysis and interpretation, manuscript writing; GMH: collection and/ or assembly of data, data analysis and interpretation, manuscript writing; CA: collection and/or ... installation of the hypobaric chamber and annexed facilities We are also grateful to Mr Juan A Silva from Universidad de Antofagasta (Chile) by his collaboration in some data collection, and...

Ngày tải lên: 18/06/2014, 15:20

6 427 0
Báo cáo hóa học: " A pilot clinical trial testing mutant von HippelLindau peptide as a novel immune therapy in metastatic Renal Cell Carcinoma" doc

Báo cáo hóa học: " A pilot clinical trial testing mutant von HippelLindau peptide as a novel immune therapy in metastatic Renal Cell Carcinoma" doc

... IL-2 and IFN -a for months as an adjuvant therapy; patient received IFN -a for lung metastasis, and patient received highdose IL-2 for metastatic mediastinal lymphadenopathy followed by radical lymph ... subcutaneously as easy and practical as they may be–reverse gradually as soon as vaccinations are completed Accordingly, we believe that such treatment needs to be continued in order to maintain ... Interferon alpha-2b compared with Interferon alpha-2b alone for metastatic renal -cell cancer J Urol 2002, 168:875 Hayakawa K, Salmeron MA, Parkinson DR, Markowitz AB, von Eschenbach AC, Legha SS, Balch...

Ngày tải lên: 18/06/2014, 16:20

9 478 0
Báo cáo hóa học: " Modulation of the major histocompatibility complex by neural stem cell-derived neurotrophic factors used for regenerative therapy in a rat model of stroke" ppt

Báo cáo hóa học: " Modulation of the major histocompatibility complex by neural stem cell-derived neurotrophic factors used for regenerative therapy in a rat model of stroke" ppt

... of the class I and II MHC, the activation of caspase III in NSC cultures and brain sections was also assayed Primary antibodies, including anti-nestin (1:150; SigmaAldrich, St Louis), anti-BrdU ... rectal temperature was monitored and maintained at 37.5° C with a thermal pad throughout the surgical procedure A scalp incision of 0.5 cm was made at one-third distal area between the left eye and ... the CNS Materials and methods Culture of Neural stem cells Neural stem cells were harvested from the cortex of E16 Sprague-Dawley rat embryos The head was decapitated and the whole brain was removed...

Ngày tải lên: 18/06/2014, 16:20

10 702 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Pediatr Res 2000, 48:6-11 19 Bernasconi A, Marino R, Ribas A, Rossi J, Ciaccio M, Oleastro M, Ornani A, Paz R, Rivarola MA, Zelazko M, Belgorosky A: Characterization of immunodeficiency in a patient ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic...

Ngày tải lên: 18/06/2014, 16:20

12 574 0
Báo cáo sinh học: "Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" doc

Báo cáo sinh học: "Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" doc

... murine macrophage cell line, Ana-1, and a human umbilical vein endothelial cell line (HUVEC) respectively As a result, the toxicity of PCFC-g-PEI and FA-PEAs on Ana-1 and HUVEC cells was homoplastic ... physic-chemical properties (size and charge) of each separate material, including PCFC-g-PEI and FA-PEAs, as well as the FA-PEAs: pVHL complexes Because PCFC-g-PEI and FA-PEAs are amphiphilic ... free FA-PEAs (data not shown) So far as FA-PEAs:pVHL complexes were concerned, as shown in Table 2, the particle size was 277.5 nm at the mass ratio (FA-PEAs versus pVHL) of 5, while the particle...

Ngày tải lên: 18/06/2014, 19:20

10 453 0
Báo cáo sinh học: " Stimulation of poliovirus RNA synthesis and virus maturation in a HeLa cell-free in vitro translation-RNA replication system by viral protein 3CDpro" docx

Báo cáo sinh học: " Stimulation of poliovirus RNA synthesis and virus maturation in a HeLa cell-free in vitro translation-RNA replication system by viral protein 3CDpro" docx

... contrast, the yield of virus from reactions templated by ribozyme-treated transcript RNAs was essentially the same as what was obtained from viral RNA (Fig 8A, compare lane with lane 5) Remarkably, ... and mature virions [36] As a size marker for these small capsid precursors, a parallel gradient was run, onto which a sample of [35S]-labeled PV-infected HeLa cell lysate was applied (designated ... (2) the final extracts were not dialyzed Translation-RNA replication reactions with HeLa cell- free extracts and plaque assays Viral RNA was translated at 34°C in the presence of unlabeled methionine,...

Ngày tải lên: 19/06/2014, 08:20

19 489 0
báo cáo hóa học:" Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" pot

báo cáo hóa học:" Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" pot

... murine macrophage cell line, Ana-1, and a human umbilical vein endothelial cell line (HUVEC) respectively As a result, the toxicity of PCFC-g-PEI and FA-PEAs on Ana-1 and HUVEC cells was homoplastic ... physic-chemical properties (size and charge) of each separate material, including PCFC-g-PEI and FA-PEAs, as well as the FA-PEAs: pVHL complexes Because PCFC-g-PEI and FA-PEAs are amphiphilic ... free FA-PEAs (data not shown) So far as FA-PEAs:pVHL complexes were concerned, as shown in Table 2, the particle size was 277.5 nm at the mass ratio (FA-PEAs versus pVHL) of 5, while the particle...

Ngày tải lên: 20/06/2014, 03:20

10 306 0
báo cáo hóa học:" Use of a novel cell-based fusion reporter assay to explore the host range of human respiratory syncytial virus F protein" ppt

báo cáo hóa học:" Use of a novel cell-based fusion reporter assay to explore the host range of human respiratory syncytial virus F protein" ppt

... (pGL3-control), and relative luciferase activity was measured To account for potential differences in host cell transcription factors that mediate activation of the reporter plasmid, the assay was flipped and ... from a known infectious cDNA sequence for subgroup A, A2 strain, [34] was synthesized with optimal codon usage for expression in mammalian cells and all potential polyadenylation sites (AATAAA) and ... reporter and activator plasmids (pFR-Luc + pBD-NFκB) As shown in figure 2A, luciferase activity was absent in cells transfected with either reporter or activator plasmids alone Additionally, mixing...

Ngày tải lên: 20/06/2014, 04:20

12 541 0
w