les from a client system to a server

dictionary of e-business [electronic resource] a definitive guide to technology and business terms

dictionary of e-business [electronic resource] a definitive guide to technology and business terms

... state changes of a transaction are involatile, and impervious to total or partial system failures (See Server and Transaction.) Acknowledge A message in an OO (Object Orientated) system that ... America, Far East, and in the Asia Pacific region including Australia and New Zealand In the Asia Pacific country of Japan, NTT’s MCS system was the first commercial delivery of a mobile 1G Japanese ... that of an analogue audio signal The maximum frame capture rate of a video capture card is a function of its maximum sampling rate which is linked to the maximum data rate at which it can operate...

Ngày tải lên: 29/05/2014, 15:31

379 3,5K 0
Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf

Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf

... that lie outside of the current database Ideally the system would have a far larger vocabulary than the current database so that it would be able to recognize items that are outside the database ... relevant fields from the database These are used in conjunction with a predefined multimodal grammar template and any available corpus training data to build a multimodal understanding model and speech ... Figure System architecture The underlying database of movie information is stored in XML format When a new database is available, a Grammar Compiler component extracts and normalizes the relevant...

Ngày tải lên: 20/02/2014, 12:20

8 586 0
Báo cáo khoa học: "A speech interface for open-domain question-answering" doc

Báo cáo khoa học: "A speech interface for open-domain question-answering" doc

... Dragon Audio Setup Wizard identified the signal -to- noise ratio as 22 dBs.) We tested a male native speaker of English and a female non-native speaker, requesting each first to train the acoustic ... interface is particularly applicable in a mobile context, in which text entry is slow and circumstances may prohibit speech altogether We fitted a 3-gram language model to the same corpus as above ... technical issues, like how and how often to update the cache and how to use hash tables for fast access, in another paper Output The original engine provided a list of sentences as hyperlinks to...

Ngày tải lên: 08/03/2014, 04:22

4 276 0
Báo cáo khoa học: "From Information Structure to Intonation: A Phonological Interface for Concept-to-Speech" pot

Báo cáo khoa học: "From Information Structure to Intonation: A Phonological Interface for Concept-to-Speech" pot

... (such as the vocalic nucleus of a syllable) Where it appears natural to so, units on certain phonological tiers are also linked to right domain edges (ms is the case with phrase and boundary tone ... collapsed representation economical and relatively transparent We note in passing that although collapsing multilinear data-structures onto a single tier increases the likeliness of combinatorial ... between intonational phra~ses (IP), are inserted by the generator in between words and these T and B are then mapped to GToBI labels (German Tones and Break Indices- (Grice et al 96)) or discarded...

Ngày tải lên: 08/03/2014, 06:20

5 498 0
Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc

Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc

... Nizar Habash, and Mona Diab 2007 Semi-Automatic Error Analysis for Large-Scale Statistical Machine Translation Systems In Proc of the MT Summit XI, Copenhagen, Denmark Maja Popovi´ and Hermann ... that arise during Spanish-Catalan translation at several levels: orthographic, morphological, lexical, semantic and syntactic errors Works towards the automatic identification and classification ... levels and generates an interactive table of scores displaying the values for all the measures Table organiza- 142 Graphically-aided Error Analysis and Diagnosis Human analysis is crucial in the...

Ngày tải lên: 16/03/2014, 20:20

6 453 0
Lab 3.1.5 Configuring a Serial Interface

Lab 3.1.5 Configuring a Serial Interface

... GAD a Enter the command show interface serial on GAD Refer to interface chart GAD#show interface serial This will show the details of interface serial b List at least three details discovered by ... there are any problems, refer to the Lab 3.1.3 Configuring Router Passwords Step Configure serial interface Serial From global configuration mode, configure serial interface Serial on Router GAD ... the name and passwords for Router a On Router 1, enter the global configuration mode and configure the hostname as shown in the chart b Configure the console, virtual terminal and enable passwords...

Ngày tải lên: 05/11/2013, 12:15

5 342 0
Tài liệu Lab 3.1.5 Configuring a Serial Interface pptx

Tài liệu Lab 3.1.5 Configuring a Serial Interface pptx

... refer to the Configuring router passwords lab Step Configure serial interface Serial From the configure terminal mode, configure serial interface Serial on Router GAD Refer to interface chart GAD(config)#interface ... configuration is not saved The router uses the startup configuration when the router is started Step Display information about Serial interface on GAD a Enter the command show interface serial on GAD ... about Serial interface on BHM a Enter the command show interface serial on BHM Refer to interface chart BHM#show interface serial This will show the details of interface serial b List at least following...

Ngày tải lên: 11/12/2013, 13:15

5 536 0
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface doc

Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface doc

... the command show interface serial (refer to interface chart) on Paris Paris#show interface serial This will show the details of interface serial Answer the following questions: a Serial is ... typing exit Remove and store the cables and adapter CCNA 4: WAN Technologies v 3.0 - Lab 3.1.7 Copyright  2003, Cisco Systems, Inc Erasing and reloading the router Enter into the privileged ... following according to the chart: • The hostname • The console • The virtual terminal • The enable passwords If there is a problem completing this, refer to the Network Address Translation (NAT) configuration...

Ngày tải lên: 11/12/2013, 13:15

6 369 0
Tài liệu Troubleshooting a Serial Interface doc

Tài liệu Troubleshooting a Serial Interface doc

... the command show interface serial (refer to interface chart) on Paris Paris#show interface serial This will show the details of interface serial Answer the following questions: a Serial is ... typing exit Remove and store the cables and adapter CCNA 4: WAN Technologies v 3.0 - Lab 3.1.7 Copyright  2003, Cisco Systems, Inc Erasing and reloading the router Enter into the privileged ... following according to the chart: • The hostname • The console • The virtual terminal • The enable passwords If there is a problem completing this, refer to the Network Address Translation (NAT) configuration...

Ngày tải lên: 11/12/2013, 15:15

6 276 0
Tài liệu Lab 3.1.5 Configuring a Serial Interface ppt

Tài liệu Lab 3.1.5 Configuring a Serial Interface ppt

... refer to the Configuring router passwords lab Step Configure serial interface Serial From the configure terminal mode, configure serial interface Serial on Router GAD Refer to interface chart GAD(config)#interface ... configuration is not saved The router uses the startup configuration when the router is started Step Display information about Serial interface on GAD a Enter the command show interface serial on GAD ... about Serial interface on BHM a Enter the command show interface serial on BHM Refer to interface chart BHM#show interface serial This will show the details of interface serial b List at least following...

Ngày tải lên: 18/01/2014, 04:20

5 433 0
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface pdf

Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface pdf

... the command show interface serial (refer to interface chart) on Paris Paris#show interface serial This will show the details of interface serial Answer the following questions: a Serial is ... typing exit Remove and store the cables and adapter CCNA 4: WAN Technologies v 3.0 - Lab 3.1.7 Copyright  2003, Cisco Systems, Inc Erasing and reloading the router Enter into the privileged ... following according to the chart: • The hostname • The console • The virtual terminal • The enable passwords If there is a problem completing this, refer to the Network Address Translation (NAT) configuration...

Ngày tải lên: 24/01/2014, 19:20

6 324 0
Tài liệu Báo cáo khoa học: "An ERP-based Brain-Computer Interface for text entry using Rapid Serial Visual Presentation and Language Modeling" ppt

Tài liệu Báo cáo khoa học: "An ERP-based Brain-Computer Interface for text entry using Rapid Serial Visual Presentation and Language Modeling" ppt

... the trial and distractor responses at channel Cz on a single-trial basis, rather than averaged over all trials The signals acquired from each EEG channel are incorporated and classified to determine ... makes the class covariances closer to the overall data covariance, and therefore to each other, thus making the quadratic boundary more similar to a linear boundary Shrinkage is applied as ˆ ˆ ˆ ... high-dimensional data, singularities of these matrices are problematic RDA applies regularization and shrinkage procedures to the class covariance matrix 40 Figure 4: Single-trial EEG data at channel...

Ngày tải lên: 20/02/2014, 05:20

6 551 0
AN1157   a serial bootloader for PIC24F devices

AN1157 a serial bootloader for PIC24F devices

... ValidateHEXFile() CLEAR SortAndPadFiles() Parse Memory Files and Save as Formatted HEX Files C Sort Memory Files, Pad to Handle Bad HEX Files EraseDataFiles() Clear Data from Memory Files L L DS0115 7A- page 18 ... have built-in data Flash memory EEPROM The bootloader allows data Flash to be read and erased at a word level, bytes at a time Erases are done on a word level prior to performing a write Not all ... 949-462-9608 Santa Clara Santa Clara, CA Tel: 408-961-6444 Fax: 408-961-6445 Toronto Mississauga, Ontario, Canada Tel: 905-673-0699 Fax: 905-673-6509 Australia - Sydney Tel: 61-2-9868-6733 Fax: 61-2-9868-6755...

Ngày tải lên: 11/01/2016, 16:47

26 533 0
Serial Interface (SCI)

Serial Interface (SCI)

... use as a counter A CR (Carriage Return) code and a LF (Line Feed) code are transmitted to effect a line feed after each line of data has printed The CR and LF are represented by H'0D and H' 0A, ... repeatedly It is assumed that SCI channel is initialized for 8-bit data, one stop bit, no parity, no interrupt, and a transfer speed of 9600 bps No error check is made on received data As a character ... synchronization using the SCI0 The following specifications are assumed here, and hardware design and register value settings are conducted accordingly • • • • • • Data transfer mode and level Data transfer...

Ngày tải lên: 29/09/2013, 11:20

18 289 0
Serial Interface to PIC

Serial Interface to PIC

... corresponds to an “ON” or 0-state (SPACE) condition −3 to −12 V corresponds to an “OFF” 1-state (MARK) condition +3 to −3 V corresponds to the “dead area” kept to absorb line noise A standard serial interfacing ... course by addition of few more hardware components and using port lines to build a home automation project Program 4.4 Controlling an actuator such as relay from PC HyperTerminal Program Source ... is smaller in size and requires no external capacitors The applications developed in this chapter resorts to MAX-232 for achieving compatibility Online tutorials for indepth information regarding...

Ngày tải lên: 03/10/2013, 01:20

10 271 0
Tài liệu Báo cáo khoa học: "A text-based search interface for Multimedia Dialectics" ppt

Tài liệu Báo cáo khoa học: "A text-based search interface for Multimedia Dialectics" ppt

... offsets Also, the user may watch the video clips of the modalities that participate in the relation (e.g a particular gesture) and/or a static image (keyframe) of a participating image region (e.g a ... cross-lingual information resources for automatically expanding and generalising the data (semantic relations) one can mine from the corpus Figure 1: The COSMOROE cross-media relations For annotating a ... “bell tower” in the background and to another image of a “bell”, through a metonymic relation of type “part for whole” What is actually happening, from a semantic point of view, is that although...

Ngày tải lên: 22/02/2014, 02:20

4 294 0
Báo cáo khoa học: "A spoken dialogue interface for TV operations based on data collected by using WOZ method" pptx

Báo cáo khoa học: "A spoken dialogue interface for TV operations based on data collected by using WOZ method" pptx

... users to select real-time broadcast programs from 19 channels It also enables the presentation of program in- Internet Digital broadcasting TV program database Individual profile management program ... synthesis, and dialogue processing of the system The IFR has been given the appearance of a stuffed animal One advantage of this IFR is that it can be directly touched and manipulated to create a feeling ... of a spoken dialogue interface for television control and to examine problem areas References FACTS (FIPA Agent Communication Technologies and Services) A1 Work Package Available at http://sharon.cselt.it/projects/facts -a1 /...

Ngày tải lên: 31/03/2014, 03:20

4 271 0
Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx

Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx

... TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG Location* Length GC % Tm(°C) Amplicon ... ACCTCTGCCTAATCATCTC ACTGTTCAAGCCTCCAAGCTGTGCCTTGG GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA ... WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG...

Ngày tải lên: 18/06/2014, 18:20

7 404 0
w