isn t personal character off the topic

The Future Isn’t What It Used To Be Changing Trends And Their Implications For Transport Planning doc

The Future Isn’t What It Used To Be Changing Trends And Their Implications For Transport Planning doc

... important thing the person is doing is piloting the car But what if the most important thing they’re doing is texting? How we free them up so they can text without needing to worry about driving? ... focus to the other side of the equation and curtail not the texting but the driving This may sound a bit facetious, but I’m serious When we worry about driving and texting, we assume that the most ... most of the Twentieth Century, but the growth rate has leveled off and declined a little in 2000 25 The Future Isn t What It Used To Be: Changing Trends And Their Implications For Transport Planning...

Ngày tải lên: 23/03/2014, 10:20

42 474 0
MY BOOK ISN''''T SELLING THE CHARGAN BOOK OF MARKETING IDEAS by Philip Ragan ppt

MY BOOK ISN''''T SELLING THE CHARGAN BOOK OF MARKETING IDEAS by Philip Ragan ppt

... and ask them to download the book from the site Ask them to contact their friends with the same request It won 't cost them anything After your download campaign is finished, you can reset the book ... Curiosity is the key Think "teaser" If you give someone a précis of the entire story, or give away the plot or the very clever twist to the story that you came up with, why will anyone then need to ... purchase If it's that kind of book, what about a local radio station or newspaper? Can you get onto the station to talk about your book topic, or contribute an article to the newspaper about it? If...

Ngày tải lên: 27/06/2014, 23:20

9 511 0
I haven''''t and I don''''t have- Khác nhau thế nào?

I haven''''t and I don''''t have- Khác nhau thế nào?

... (Tienganh.com.vn) ...

Ngày tải lên: 16/09/2013, 12:10

2 508 0
Lịch hoạt động cụ thể của tổ trưởng chuyên môn lập theo tuần

Lịch hoạt động cụ thể của tổ trưởng chuyên môn lập theo tuần

... – 7/5 9/5 – 28/5 - tiế t - tiế t - tiế t - tiế t - tiế t + Nghỉ t t Nguyên Đán tuần - tiế t - tiế t - tiế t - tiế t - tiế t - tiế t - tiế t Ca t Lâm, ngày … tháng … năm 2010 ... hoat đông cua t trương chuyên môn t 4-5 Năm hoc: 2010-2011 ̉ ̣ Trườ ng Tiêu hoc Ca t Lâm ̉ ̉ ̣ ̣ ̣ ̣ ̉ ̉ Lich hoat đông cua t trương chuyên môn t 4-5 Năm hoc: 2010-2011 ̉ ̣ Trườ ng Tiêu ... KT hồ sơ - tiế t - tiế t - tiế t 23 31/1 – 12/2 - Dự giờ - KT hồ sơ - Làm báo cáo sơ kế t, lâ ̣p kế hoa ̣ch tháng - Dự giờ - KT hồ sơ 24 25 26 27 28 14/2 – 19/2 - Dự giờ - tiế...

Ngày tải lên: 25/09/2013, 12:10

4 362 1
GIẢI PHÁP CẢI THIỆN CHUỖI CUNG ỨNG MẶT HÀNG TÔM THẺ CHÂN TRẮNG ĐÔNG LẠNH CỦA CÔNG TY CP NHA TRANG SEAFOODS

GIẢI PHÁP CẢI THIỆN CHUỖI CUNG ỨNG MẶT HÀNG TÔM THẺ CHÂN TRẮNG ĐÔNG LẠNH CỦA CÔNG TY CP NHA TRANG SEAFOODS

... công ty Dẫn đến làm chậm tiến trình xu t hàng, thủ t c Hải quan, ảnh hưởng xấu t i uy t n công ty đối t c T thực trạng đó, cho thấy vấn đề đầu t nâng cấp công nghệ thông tin, thực công t c theo ... cấp su t trình nuôi - Kỹ thu t: hỗ trợ kỹ thu t nuôi tiên tiến, nuôi theo mô hình an toàn sinh học, đảm  bảo yếu t môi trường đ t tiêu chuẩn Global GAP EU Bao tiêu sản phẩm sau thu hoạch theo ... đổi thông tin t t, chuyển giao đầy đủ người nhận thông tin dễ dàng kiểm so t thực t t chức đ t hiệu qủa cao công việc • Sự cần thi t giải pháp Hiện t i, hệ thống thông tin công ty ho t động t ơng...

Ngày tải lên: 30/09/2013, 09:20

13 640 0
Taking spam off the menu

Taking spam off the menu

... has it that in the event of a nuclear meltdown, the two groups virtually guaranteed to survive are rats and cockroaches This applies to the Internet as well In the event of a total system shutdown, ... wish to be excluded from future mailings, please use the link at the bottom of the page The general idea is always the same To get off the mailing list, you need to visit the spammer’s website ... missed the point Anthony’s real goal wasn t to sell the services being SPIMmed; it was to extort money from MySpace He actually contacted them and offered to protect their users against SPIM...

Ngày tải lên: 05/10/2013, 15:20

14 266 0
Is Constitutional Interpretation Different. Why It Isn’t and Is

Is Constitutional Interpretation Different. Why It Isn’t and Is

... interpreter of those terms must seek their true nature and not what the constitutional authors believed that nature to be That is intentionalist interpretation, not something else The constitutional ... of the term, the dominance of the conventional definition of the term, or the dominance of the real nature of the term The intentionalist seeks the dominant authorial intention If, therefore, the ... by the governed Such acceptance is the “turtle” on which the authority of Article VII rests and, with it, the authority of the remainder of the Constitution and the statutes, treaties, and other...

Ngày tải lên: 01/11/2013, 08:20

13 331 0
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

... confessedly due to the fact that the men rowed when they were not in a fit state of health; in others, to the rowers being by nature constitutionally delicate; and in others again, to their having thoroughly ... not fit to engage in a contest which it has been said taxes to the utmost extent all the strength of the system for upwards of twenty minutes C, who rowed comparatively lately, is another instance ... better than those of the Cambridge Oars; the former averaging 437 years instead of 40 after the race, while the latter cannot be credited with more than 407 This is due to the fact that out of...

Ngày tải lên: 14/02/2014, 21:20

419 542 0
Tài liệu Báo cáo khoa học: Accessibility changes within diphtheria toxin T domain when in the functional molten globule state, as determined using hydrogen⁄deuterium exchange measurements pdf

Tài liệu Báo cáo khoa học: Accessibility changes within diphtheria toxin T domain when in the functional molten globule state, as determined using hydrogen⁄deuterium exchange measurements pdf

... concentrations, etc In the case of the T domain, the MG state corresponds to the functional state, which initiates the translocation of the catalytic domain Here, the data allowed identification ... of the core of the protein in the N state and the evolution of the overall structure of the protein in the MG state This degree of resolution is unprecedented for the T domain of the diphtheria ... protection of TH5 is a result of dimer formation, the dimer may be still present in the MG state The most protected region of the protein in the MG state is TH9 (Fig 5B) Indeed, after the longest time...

Ngày tải lên: 16/02/2014, 09:20

10 531 0
Tài liệu Báo cáo khoa học: Altered deoxyribonucleotide pools in T-lymphoblastoid cells expressing the multisubstrate nucleoside kinase of Drosophila melanogaster doc

Tài liệu Báo cáo khoa học: Altered deoxyribonucleotide pools in T-lymphoblastoid cells expressing the multisubstrate nucleoside kinase of Drosophila melanogaster doc

... before storage in a )80 °C freezer until required for analysis A primer template mix was prepared through the ligation of a tailor-made oligo template (T; 5¢-TTTGTT TGTTTGTTTGTTTGGGCGGTGGAGGCGG-3¢) ... with the control CEM cells, but not with H9 cells where there were no marked differences in cytostatic activity against the transfected vs nontransfected cells The molecular basis of the latter ... results and those of previous reports One of the most important differences may be the cell type used in the different studies The toxicity of nucleosides, as well as the sensitivity towards cytotoxic...

Ngày tải lên: 20/02/2014, 01:20

11 506 0
When Chicken Soup Isn’t Enough ppt

When Chicken Soup Isn’t Enough ppt

... notion that they are “patient advocates.” So, if that is the case, what does advocacy mean? I think to some nurses, it means that they want the best for their patients; they xvi · Introduction ... and the public are long overdue for an antidote to the platitudes that purport to feed the nurse’s soul There are so many better stories to tell We need a collection, I felt, that spotlights the ... willing to the job), and they didn t want their manager present After each meeting they would complain among themselves about the facilitator and about the fact that their manager’s presence inhibited...

Ngày tải lên: 05/03/2014, 11:21

269 2,2K 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

... 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third PCR was carried out using PCR products, the first PCR 5¢ primer and the second ... first PCR were: 5¢ primer, 5¢-CATGCCATGGCCAGTAGTCAGCCTGA CCCTACTCCAG-3¢ and 3¢ primer, 5¢-GGTTATCATA TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ ... 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen SSA (Eur J Biochem 271) 4077 TAAGGTGAAC-3¢) that had NcoI and BamHI restriction sites, respectively...

Ngày tải lên: 07/03/2014, 16:20

9 485 0
Báo cáo khoa học: "An Off-the-shelf Language Identification Tool" potx

Báo cáo khoa học: "An Off-the-shelf Language Identification Tool" potx

... Python module, and provides a function that accepts text and returns the identified language of the text This use of langid.py is the fastest in a single-processor setting as it incurs the least ... majority of documents were classified as Polish We suspect that this is due to the early termination criteria employed by LangDetect, together with specific characteristics of the corpus TextCat also ... an alternative domain such as Twitter messages, where both langid.py and LangDetect attain better accuracy than CLD An interesting point of comparison between the Twitter datasets is how the accuracy...

Ngày tải lên: 07/03/2014, 18:20

6 424 0
Off the Rim Basketball and Other Religions in a Carolina Childhood docx

Off the Rim Basketball and Other Religions in a Carolina Childhood docx

... And it doesn t take into account all the other trappings of Southern Gothic on the street—William Ball who lived by himself just up the street, who sat in his front porch swing, glared at the ... on the map those municipalities, learned their populations, romanticized them (then deromanticized them twenty years later when I saw the actual places), wondered what they were like Through the ... restaurants and hotels, sometimes in the North as well as the South But I learned that at least in some parts of the country, and at least in one arena, the arena I valued most, they competed...

Ngày tải lên: 08/03/2014, 16:20

260 492 0
Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks " doc

Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks " doc

... curve in the graph that is itself a multi-valued graph over the circle) into three parts where the middle sheet is the second part The idea is then that the first and third parts have subsectors which ... sheets that we started with.) The last statement is a result from [CM3] to guarantee as we patch together these multi-valued graphs coming from different scales that the surface obtained is still ... for r1 ≤ t ≤ R1 /4 To complete the proof, we will use the stability inequality together with the logarithmic cutoff trick to take advantage of the quadratic area growth Define a cutoff function ψ1...

Ngày tải lên: 14/03/2014, 22:20

43 410 0
i didn t do it how the simpsons affects kids

i didn t do it how the simpsons affects kids

... Homer and Bart were scouring the parking lot for winning tickets into the night, they saw the track manager throw out a dog It was not just any dog, it was Santa's Little Helper When Bart and Homer ... and Trich, 19) In the episode, Bart got a tattoo, much to Marge's dislike She quickly spent all of the family's Christmas money to remove Bart's tattoo with a laser At the same time, Homer, still ... requests that Bart attends The Enriched Learning Center for Children Suddenly, Homer takes a liking to his son They joke together, play ball together, embarrass Marge at an opera together ("Toreador,...

Ngày tải lên: 21/03/2014, 22:04

7 500 0
w