hepatitis c virus infection

Báo cáo y học: "Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report" pptx

Báo cáo y học: "Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report" pptx

... hand, clinical characteristics and circumstantial evidence suggest that idiosyncratic drug reactions are caused by reactive metabolites and are immune-mediated The possible mechanisms of stem cell ... doi:10.1186/1752-1947-4-268 Cite this article as: Ioannou et al.: Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report Journal of Medical Case Reports ... ribonucleic acid; WBC: white blood cells Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written consent...

Ngày tải lên: 11/08/2014, 03:21

5 352 0
báo cáo khoa học: " HIV and hepatitis C virus infections among hanka injection drug users in central Ukraine: a cross-sectional survey" ppt

báo cáo khoa học: " HIV and hepatitis C virus infections among hanka injection drug users in central Ukraine: a cross-sectional survey" ppt

... participants were co-infected with HIV and HCV HCV may facilitate HIV disease progression and increase the incidence of liver toxicity associated with certain antiretroviral regimens HCV co -infection ... Harm Reduction Journal 2009, 6:23 http://www.harmreductionjournal.com/content/6/1/23 Table 2: Univariate analysis of categorical factors associated with HIV and hepatitis C virus (HCV) infections ... http://www.harmreductionjournal.com/content/6/1/23 Table 2: Univariate analysis of categorical factors associated with HIV and hepatitis C virus (HCV) infections among injection drug users in Vinnitsya,...

Ngày tải lên: 11/08/2014, 18:20

9 331 0
Báo cáo y học: "Differential expression of interferon-induced microRNAs in patients with chronic hepatitis C virus infection treated with pegylated interferon alpha" potx

Báo cáo y học: "Differential expression of interferon-induced microRNAs in patients with chronic hepatitis C virus infection treated with pegylated interferon alpha" potx

... (forward primer, 5’-CTGCCTGGCAGAAAACTTACC-3’; reverse primer, 5’-CTCTGTTATTCTCTGGTGAGTCT CCTT-3’; probe, 5’CATCACACATATCTGTAAATCTC TGCCCCTGTTAGA-3’) Co-amplification of the betaglucuronidase gene ... reverse Scagnolari et al Virology Journal 2010, 7:311 http://www.virologyj.com/content/7/1/311 Page of Table Demographic and clinical characteristics of patients with chronic hepatitis C Patient ... performing selection of patients with CHC and analysing of clinical data; JV was responsible for performing selection of patients with CHC and analysis of clinical data; CS was responsible for executing...

Ngày tải lên: 12/08/2014, 02:20

9 336 0
Báo cáo y học: "Prevalence of active hepatitis c virus infection in district mansehra pakistan" docx

Báo cáo y học: "Prevalence of active hepatitis c virus infection in district mansehra pakistan" docx

... females is considered to play a role in the spontaneous clearance of HCV infection [34] Abbreviations cDNA: complementary DNA; HCV: hepatitis C virus; IBGE: Institute of Biotechnology and Genetic Engineering; ... ICT: Immno-chromatographic Test; KP: Khyber Pukhtoonkhwa; M-MLV: Molony-murine leukemia virus; PCR: Polymerase chain reaction; RNA: Ribonucleic acid; RT PCR: Reverse transcription polymerase chain ... of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar...

Ngày tải lên: 12/08/2014, 02:20

5 268 0
Báo cáo y học: " Hepatitis C virus infection in Brazilian long-distance truck drivers" pptx

Báo cáo y học: " Hepatitis C virus infection in Brazilian long-distance truck drivers" pptx

... Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for ... Prevalence and 95% confidence intervals (95% CI) were calculated Fisher’s exact test was used to evaluate association between variables and HCV infection (defined as positive for anti-HCV) These, ... independent associated with HCV infection in the study population Regarding blood transfusion, HCV infection was associated with this procedure before the introduction of screening for anti-HCV antibodies...

Ngày tải lên: 12/08/2014, 04:20

6 381 0
Báo cáo khoa học: "Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

Báo cáo khoa học: "Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

... Glucose intolerance in liver cirrhosis: role of hepatic and non-hepatic influences Eur J Clin Chem Clin Biochem 1994, 32(10):749-58 Del Vecchio Blanco C, Gentile S, Marmo R, Carbone L, Coltorti M: ... Hepatology 1997, 26:625-655 Centers for Disease Control and Prevention: Recommendations for prevention and control of hepatitis C virus (HVC) infection and HVC-related chronic disease Morbidity and ... covers clinical characteristics, demographic characteristics and social behaviors, which could be possible risk factors to acquiring HCV Statistical Analysis General descriptive analysis was used...

Ngày tải lên: 12/08/2014, 04:21

5 463 0
Báo cáo khoa học: " Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" ppsx

Báo cáo khoa học: " Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" ppsx

... permissiveness of the cell for HCVcc infection [10,11], we sought to determine if Huh7 3-D cultures were permissive for HCVcc infection As such, 3-D Huh7 cultures were inoculated with HCVcc JFH-1 1, 7, ... of HCV infection and antiviral drug studies in more polarized, xenobiotically-competent cells Figure Robust HCVcc infection in 3-D Huh7 RWV cultures Robust HCVcc infection in 3-D Huh7 RWV cultures ... Uprichard SL: Hepatitis C Virus infection in phenotypically distinct Huh7 cell lines PLoS ONE 2009 in press Uprichard SL, Chung J, Chisari FV, Wakita T: Replication of a hepatitis C virus replicon...

Ngày tải lên: 12/08/2014, 04:21

8 326 0
Báo cáo khoa học: " Hepatitis C Virus infection in apparentenly healthy individuals with family history of diabetes in Vom, Plateau State Nigeria" ppsx

Báo cáo khoa học: " Hepatitis C Virus infection in apparentenly healthy individuals with family history of diabetes in Vom, Plateau State Nigeria" ppsx

... inflammatory cytokines like tumor necrosis factor- alpha are increased in acute alcoholic hepatitis and such cytokines induce insulin resistance and glucose intolerance which could consequently cause ... G, Schattner A: Increased risk of type diabetes in noncirrhotic patients with chronic hepatitis C virus infection Mayo Clin Proc 2000, 75:355-359 Zein CO, Levy C, Basu A, Zein NN: Chronic hepatitis ... percent of patients with acute hepatitis C ultimately develop chronic infection Researchers estimate that at least 20 percent of patients with chronic hepatitis C develop cirrhosis, a process...

Ngày tải lên: 12/08/2014, 04:21

6 291 0
Báo cáo khoa học: "Ethnic and geographical differences in HLA associations with the outcome of hepatitis C virus infection" pot

Báo cáo khoa học: "Ethnic and geographical differences in HLA associations with the outcome of hepatitis C virus infection" pot

... MC, Diepolder HM, Schirren CA, Schraut WW, Hoffmann R, Zachoval R, Santantonio T, Cucchiarini M, et al.: Association of hepatitis C virus- specific CD8+ T cells with viral clearance in acute hepatitis ... British Irish Baltimore Baltimore Chicago Baltimore, Chicago Philadelphia Philadelphia Chicago Baltimore, Chicago Baltimore Chicago Chicago Baltimore Chicago Chicago Chicago Baltimore Irish, German ... presenting cells or on infected cells such as hepatocytes CD8 or CD4 T cells can recognize the complex of HLA- class I peptides or class II peptides and act as either effector T cells, helper T cells,...

Ngày tải lên: 12/08/2014, 04:21

8 499 0
Báo cáo khoa học: " Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

Báo cáo khoa học: " Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

... Glucose intolerance in liver cirrhosis: role of hepatic and non-hepatic influences Eur J Clin Chem Clin Biochem 1994, 32(10):749-58 Del Vecchio Blanco C, Gentile S, Marmo R, Carbone L, Coltorti M: ... Hepatology 1997, 26:625-655 Centers for Disease Control and Prevention: Recommendations for prevention and control of hepatitis C virus (HVC) infection and HVC-related chronic disease Morbidity and ... covers clinical characteristics, demographic characteristics and social behaviors, which could be possible risk factors to acquiring HCV Statistical Analysis General descriptive analysis was used...

Ngày tải lên: 12/08/2014, 04:22

5 209 0
Báo cáo khoa học: "Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" pdf

Báo cáo khoa học: "Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" pdf

... permissiveness of the cell for HCVcc infection [10,11], we sought to determine if Huh7 3-D cultures were permissive for HCVcc infection As such, 3-D Huh7 cultures were inoculated with HCVcc JFH-1 1, 7, ... of HCV infection and antiviral drug studies in more polarized, xenobiotically-competent cells Figure Robust HCVcc infection in 3-D Huh7 RWV cultures Robust HCVcc infection in 3-D Huh7 RWV cultures ... Uprichard SL: Hepatitis C Virus infection in phenotypically distinct Huh7 cell lines PLoS ONE 2009 in press Uprichard SL, Chung J, Chisari FV, Wakita T: Replication of a hepatitis C virus replicon...

Ngày tải lên: 12/08/2014, 04:22

8 642 0
Báo cáo khoa học: " Hepatitis C Virus infection in apparentenly healthy individuals with family history of diabetes in Vom, Plateau State Nigeria" pot

Báo cáo khoa học: " Hepatitis C Virus infection in apparentenly healthy individuals with family history of diabetes in Vom, Plateau State Nigeria" pot

... inflammatory cytokines like tumor necrosis factor- alpha are increased in acute alcoholic hepatitis and such cytokines induce insulin resistance and glucose intolerance which could consequently cause ... G, Schattner A: Increased risk of type diabetes in noncirrhotic patients with chronic hepatitis C virus infection Mayo Clin Proc 2000, 75:355-359 Zein CO, Levy C, Basu A, Zein NN: Chronic hepatitis ... percent of patients with acute hepatitis C ultimately develop chronic infection Researchers estimate that at least 20 percent of patients with chronic hepatitis C develop cirrhosis, a process...

Ngày tải lên: 12/08/2014, 04:22

6 245 0
Safe Blood Transfusion- Screening for Hepatitis B and Hepatitis C Virus Infections in Potential Blood Donors in Rural Southeast Asia

Safe Blood Transfusion- Screening for Hepatitis B and Hepatitis C Virus Infections in Potential Blood Donors in Rural Southeast Asia

... Antibodies to Hepatitis B surface antigen Anti-HCV Antibodies to Hepatitis C BCP Basal Core Promoter cccDNA Covalently Closed Circular DNA CHC Chronic hepatitis C CMIA Chemiluminescent Microparticle Immunoassay ... as-yet-unknown receptor, nucleocapsids transport their cargo – the genomic HBV DNA – to the nucleus, where the relaxed circular DNA is converted to covalently closed circulation DNA (cccDNA) The cccDNA serves ... hepatocellular carcinoma (HCC) within 30 years after initial HCV infection [127] 31 HEPATITIS C DIAGNOSTIC ASSAYS Diagnostic tests for HCV infections include serologic assays for HCV antibodies and molecular...

Ngày tải lên: 03/03/2015, 21:05

64 465 0
Sống tốt với việc bị nhiễm siêu vi trùng viêm gan C - Living Well with Hepatitis C Virus Infection

Sống tốt với việc bị nhiễm siêu vi trùng viêm gan C - Living Well with Hepatitis C Virus Infection

... HealthLinkBC File #25a Thu c chủng ngừa bệnh viêm gan B HealthLinkBC File #33 Thu c Chủng Ngừa Bệnh Viêm Gan A • Chích thu c chủng ngừa viêm phổi (pneumococcal polysaccharide vaccine) sau chích liều ... nh c lại năm sau Thu c chủng liều chích tăng c ờng miễn phí cho người bị nhiễm HCV Để c thêm thơng tin, xin xem HealthLinkBC File #62b Thu c Chủng Ngừa Phế C u Khuẩn Polysaccharide • Chích ngừa ... Polysaccharide • Chích ngừa c m năm Thu c chủng ngừa miễn phí cho người bị nhiễm HCV thường c sẵn vào tháng Mười Để bảo vệ tốt cho mình, q vị nên chích thu c chủng ngừa thu c vừa c Để biết thêm thơng...

Ngày tải lên: 20/07/2015, 23:38

2 158 0
Nhiễm siêu vi trùng viêm gan C - Hepatitis C Virus Infection

Nhiễm siêu vi trùng viêm gan C - Hepatitis C Virus Infection

... quý vị c vết c t trầy xư c hay bạn c kinh nguyệt; • bị c n hay chích trùng, trùng lại c n hay chích người kh c; • da lành lặn người kh c tiếp x c với chất dịch thể quý vị chẳng hạn nư c miếng, ... bệnh c m chích miễn phí cho người bị nhiễm siêu vi trùng viêm gan C Quý vị chích thu c chủng ngừa đơn vị y tế c ng c ng địa phương văn phòng người chăm s c s c khỏe cho quý vị Để biết thêm chi ... chất dịch kh c thể, chẳng hạn tinh dịch chất tiết từ âm đạo Nguy tăng thêm c máu lẫn lộn chung với chất dịch Hiện nay, khơng c thu c chủng để giúp người ta phòng ngừa vi c khơng bị nhiễm HCV...

Ngày tải lên: 20/07/2015, 23:38

2 269 0
Hepatitis c virus infection in patients on maintenance dialysis

Hepatitis c virus infection in patients on maintenance dialysis

... post-transfusion hepatitis C virus infection N Engl J Med 1992; 327:369 20 Cendoroglo Neto M, Draibe SA, Silva AE, et al Incidence of and risk factors for hepatitis B virus and hepatitis C virus infection ... Masuko K, et al Hepatitis C virus infection in medical personnel after needlestick accident Hepatology 1992; 16:1109 37 Alter MJ The epidemiology of acute and chronic hepatitis C Clin Liver Dis ... Lunghi G, Locatelli F Membrane compatibility, flux and HCV infection in dialysis http://www.uptodate.com/contents /hepatitis- c- virus- infection- in-patients-on-maintenance-dialysis?source=search_result&search=Hepatitic+bile+duct+injuri…...

Ngày tải lên: 15/02/2017, 16:11

5 262 0
Báo cáo y học: "Hepatitis C Virus (HCV) Infection and Hepatic Steatosis"

Báo cáo y học: "Hepatitis C Virus (HCV) Infection and Hepatic Steatosis"

... liver cancer in transgenic mice expressing the structural and nonstructural proteins of hepatitis C virus Gastroenterology 2002;122:352-65 32 Castera L, Chouteau P, Hezode C, et al Hepatitis C Virus- Induced ... that the hepatitis C virus, in and of itself, can directly induce cytoplasmic lipid accumulation Further studies examining the genotype virus are warranted to further recognize the process involved ... that is directly induced by the hepatitis C virus and which also resolves with successful treatment These two forms of steatosis can certainly coexist in patients with genotype 54 infections with...

Ngày tải lên: 02/11/2012, 09:51

4 438 0
Báo cáo y học: "Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) Dual Infection"

Báo cáo y học: "Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) Dual Infection"

... that occult infection may contribute to chronic liver damage and the development of HCC [32, 33, 34, 35] Cacciola [36] studied the prevalence and clinical significance of occult HBV infection ... seroclearance Int J Med Sci 2006, 60 Dual Infection of HBV and HCV and hepatocellular carcinoma (HCC) Conflict of interest HBV and HCV infections are confirmed causes of HCC What’s the combined ... effect of HBV and HCV coinfection on HCC? Accumulated epidemiological data suggested that coinfection with HBV and HCV could increase the risk for development of HCC A case-control study [51] conducted...

Ngày tải lên: 02/11/2012, 09:51

6 621 1
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

... [Internet] CDC: US Viral Hepatitis C http://www.cdc.gov/ncidod/diseases /hepatitis/ c/ plan/Prev_Co ntrol.htm 84 Backmund M, Reimer J, Meyer K, Gerlach JT, Zachoval R Hepatitis C virus infection and injection ... Orlando G, Casciani CU Hepatitis C virus infection in Italian kidney graft recipients Changing risk factors and hepatitis C virus genotypes Ital J Gastroenterology Hepatology 1997; 29:448-55 67 Cheung ... for Hepatitis C virus all need to be elucidated Conflict of interest The authors have declared that no conflict of interest exists References WHO Global surveillance and control of hepatitis C...

Ngày tải lên: 02/11/2012, 09:56

6 486 0
Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"

Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"

... estimated 10%20% of chronic HCV infections advance to end-stage liver disease over one or two decades Extrahepatic manifestations can occur during chronic HCV infection or cirrhosis, but HCC appears to ... ages Coinfection with HIV and HBV HCV coinfections with HIV or HBV are significant risk factors for liver fibrosis Coinfection with HCV and HIV is particularly common among hemophiliacs and injection ... immunodeficiency virus and hepatitis C virus coinfected patients The Multivirc Group Hepatology, 1999 30(4): 1054-8 43 Di Martino V, et al The influence of human immunodeficiency virus coinfection on chronic...

Ngày tải lên: 02/11/2012, 09:56

6 531 0
w