h 2 in galois cohomology by t a springer

Contemporary Issues in Bioethics Edited by Peter A. Clark pdf

Contemporary Issues in Bioethics Edited by Peter A. Clark pdf

... be ethically viewed as an omission rather than an act, for example, the withdrawal of active treatment and the starting of palliative management for a patient with a terminal condition The principle ... doesn t happen in this life, but rather in the next) 5 .2 Advantages and disadvantages of Kantian ethics Kant’s ethical theory provides an insight to clinicians that rules are important in ethics ... our actions are important and should be taken into account in the ethical process As well as these considerable strengths, the greatest advantage of Utilitarianism is that it captures the heart...

Ngày tải lên: 08/03/2014, 00:20

162 406 0
Modeling in MathWorks Simscape  by building a model of an automatic  gearbox

Modeling in MathWorks Simscape by building a model of an automatic gearbox

... attached to an electrical node must be the same If this approach is transferred to the mechanical rotational domain it means that the angular velocity at all of the component’s ports attached to that ... of the parameters used in the clutch model Most impact for the two tests has the pressure parameter which actuates the clutch For the two tests all clutches are actuated with a value of In a more ... Discrete events refers to that the state variables change at specific points in time and in a continous simulation the states variables change continously Normally in a continous simulation the variables...

Ngày tải lên: 24/07/2014, 09:44

63 470 0
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx

Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx

... Kent and another section of the valley stretching from the town of Grande Isle to the town of Hamlin The two areas were delineated as the research site because they are areas that contain all four ... 1964) Table 12 TILL Kite’s interpretations at point stations Derivative map’s classifications at point stations Agreement between Kite and the derivative map The probability Kite’s interpretations ... Outwash classifications on the derivative map are scattered the length of the St John and at the mouth of tributary streams They mostly lie adjoining the river in conjunction with alluvial and...

Ngày tải lên: 08/03/2014, 23:20

131 599 0
Schizophrenia in the 21 Century Edited by T.H.J. Burne docx

Schizophrenia in the 21 Century Edited by T.H.J. Burne docx

... validated measures in available trials This is clearly an area that pharma and the research community must address There are signs again that this is changing The FDA has recognised the importance ... persons with mental illness was greater in Japan than in China The reasons for these results include the fact that there are many advanced mental health care inpatient facilities as well as a few ... compulsory community treatment The mental health laws dictate the family’s obligation to ensure treatment and medical care for the patient The mental health laws explain that the compulsory admission...

Ngày tải lên: 23/03/2014, 16:21

194 240 0
Chương 7I. BI U DI N S :H TH NG SCƠ B NM t s trong h th ng s ñư c t o ra t m t hay nhi u ký s (digit), có th bao g m 2 ph n: ph n nguyên và ph n l , ñư c phân cách nhau b ng d u ch m cơ s (radix). Tr ng s (Weight) c a m i ký s ph thu c vào v trí c pdf

Chương 7I. BI U DI N S :H TH NG SCƠ B NM t s trong h th ng s ñư c t o ra t m t hay nhi u ký s (digit), có th bao g m 2 ph n: ph n nguyên và ph n l , ñư c phân cách nhau b ng d u ch m cơ s (radix). Tr ng s (Weight) c a m i ký s ph thu c vào v trí c pdf

... Th Kim Anh 33 ð nh ly 3: (lu t phu đ nh c a phu đ nh) A= A ð nh ly 4: A+ 1=1 A. 0=0 T ng qt: A + B + C + … + = A B C …… = ð nh ly 5: (lu t đ ng nh t) A+ A =A A .A= A T ng qt: A+ A +A+ … +A= A A A A ... thu t ði n t GV: Lê Th Kim Anh 43 TRƯ NG H P T Y ð NH Trong th c t có nh ng trư ng h p m t vài t h p nh phân c a bi n khơng x y Do đó, giá tr c a h m t ơng ng v i nh ng t h p nh phân có th hay ... (A+ B)* (A+ C) Bài gi ng mơn K thu t ði n t GV: Lê Th Kim Anh 31 ∃ hai ph n t trung h a đư c ký hi u A+ 0 =A A*1= A A X, ∃ ph n t bù c a A, đư c ký hi u A : ∈ A+ A =1 A* A = T p (X,+,*,0,1, NOT) th a tiên...

Ngày tải lên: 01/04/2014, 11:21

84 508 0
Báo cáo y học: "Altered expression of inflammatory cytokines in primary osteoarthritis by human T lymphotropic virus type I retrovirus infection: a cross-sectional study" pps

Báo cáo y học: "Altered expression of inflammatory cytokines in primary osteoarthritis by human T lymphotropic virus type I retrovirus infection: a cross-sectional study" pps

... lower than those in RA patients [18], and were not correlated with erythrocyte sedimentation rate or C-reactive protein, suggesting that the mechanism(s) involved in the activation of PTHrP in HTLV-I ... carrier patients R351 Arthritis Research & Therapy Vol No Yoshihara et al Table C-terminal parathyroid hormone (C-PTHrP) concentration, radiographic changes, histopathological features and Tax ... it is possible that the altered inflammatory activity is partial and transient during the natural course of OA and does not continue to the final stage In contrast to the development of systemic...

Ngày tải lên: 09/08/2014, 01:23

8 602 0
Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

... AAG GTT ATT GTG GTA GT-3' mTLR4 lower 5'-TGC CGT TTC TTG TTC TTC CTC T- 3' mTLR6 upper 5'-ATA CCA CCG TTC TCC ATT T- 3' mTLR6 lower 5'-GAC GTG CTC TAT CAT CAG TG-3' FACS sorting, by using a panel ... present data reveal a new method of co-stimulation of T cells via TLR -2 that might have a critical role in pathogeninduced immunopathology The important finding that bacterial lipoproteins can trigger ... cultivated on plate-bound anti-haIgG or anti-CD3 mAb Note that the proliferative response of TLR -2- /- CTLs with anti-CD3 mAb alone was higher than that of B6 and TLR-4def CTLs, but that it was...

Ngày tải lên: 09/08/2014, 01:23

14 506 0
T.a 6 HK II (2)

T.a 6 HK II (2)

... cho 0,5 điểm yes she’s she is going to visit Da Lat yes she does she is going to stay in a hotel IV/ (2 điểm) Mỗi câu cho 0,5 điểm 1.-b >d - a -c V/ (2 điểm) Mỗi câu cho điểm 1.We often play ... ÁN VÀ H ỚNG DẪN CHẤM ĐỀ KIỂM TRA CH T LƯỢNG H C KỲ II MÔN ANH I/ (2 điểm) Mỗi câu cho 0,5 điểm 1.Go Is riding Is not 4.plays II/ (2 điểm) Mỗi câu chọn cho 0,5 điểm 1.Is 2. In cool often III/ (2 điểm) ... 0,5 điểm 1.-b >d - a -c V/ (2 điểm) Mỗi câu cho điểm 1.We often play badminton in the summer It is cold when I go swimming ...

Ngày tải lên: 01/07/2013, 01:26

2 350 0
Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling

Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling

... untreated water is shown in Figure The total bacterial count in the untreated water dropped rapidly at first stage and slowly at second stage in the SC-CO2 treatment and the inactivation rate increased ... flow rate and exposure time in the SC-CO2 treatment on the inactivation of coliform and total bacteria in untreated water and to propose the SC-CO2 treatment as a novel method for inactivating ... β-glucuronidase and α-glucosidase, were completely inactivated by the SC-CO2 treatment, whereas phosphatase (alkaline and acid) or naphthol-AS-BI-phosphohydrolase was slightly or a little inactivated Ishikawa...

Ngày tải lên: 05/09/2013, 09:38

10 451 1
Hoc T.a qua bai hat (fill in the blanks)

Hoc T.a qua bai hat (fill in the blanks)

... with me in the possibility * I don 't wanna be like this I just wanna …………… you know that everything that I hold in 'Cause ……………… that I can 't let go (can 't let go, yeah) * Don 't you know it baby ... much to give (I have so much to give) With a player like you I don 't have a prayer That's the way to ………………… Ohhhh mmmm noooo It's just too little too late Yeaahhhh * You say you dream of my face ... I'm starting to move on I'm gonna say this now Your chance has ……………… and gone And you know:* It's just too little too late A little too ……… And I can 't wait But you know all the right things to...

Ngày tải lên: 15/09/2013, 07:10

3 655 1
KT T.A 12 lan 2 HKI (Unit 4,5,6)

KT T.A 12 lan 2 HKI (Unit 4,5,6)

... he studied hard, he wouldn 't fail the final exam B If he had studied hard, he might pass the final exam C If he had studied hard , he could have passed the final exam D He didn 't fail the final ... study hard, so he failed the final exam A If he studied hard, he wouldn 't fail the final exam B If he had studied hard, he might pass the final exam C If he had studied hard , he could have passed ... of mine The most exciting thing was that I didn t have to explain to my parents where I was going , who with, or what time I’d be home ! On Saturday night, I followed my roommate to a party The...

Ngày tải lên: 14/10/2013, 01:11

7 1,1K 27
KT T.A 12 CB lan 2 HKI ( Unit4,5,6)

KT T.A 12 CB lan 2 HKI ( Unit4,5,6)

... he studied hard, he wouldn 't fail the final exam B If he had studied hard, he might pass the final exam C If he had studied hard , he could have passed the final exam D He didn 't fail the final ... study hard, so he failed the final exam A If he studied hard, he wouldn 't fail the final exam B If he had studied hard, he might pass the final exam C If he had studied hard , he could have passed ... of mine The most exciting thing was that I didn t have to explain to my parents where I was going , who with, or what time I’d be home ! On Saturday night, I followed my roommate to a party The...

Ngày tải lên: 14/10/2013, 01:11

7 451 0
KT T.A 11HKI lan 2 ( unit 4,5,6)

KT T.A 11HKI lan 2 ( unit 4,5,6)

... techniques and family planning Before they left, they promised ( 24 ) back the next summer 21 A against B for C to D with 22 A to teach B teaching C teach D taught 23 A with B for C about D from 24 ... they left, they promised ( 28 ) back the next summer 25 A against B for C to D with 26 A to teach B teaching C teach D taught 27 A with B for C about D from 28 A. coming b come C came D to come ... A eradicate B eradicated C eradicating D eradication IV READING The students who took part in the fight ( 21 ) _ illiteracy considered it an honorable job to help people in their villages They...

Ngày tải lên: 17/10/2013, 03:11

6 496 4
A study on increasing students’ participation in communicative activities in large classes by using group work and questioning technique at marie curie high school, hai phong

A study on increasing students’ participation in communicative activities in large classes by using group work and questioning technique at marie curie high school, hai phong

... concentrate on “what” they are saying rather than “how” they are saying it - The students work independently off the teacher - The students determine what they want to write and say The activity ... time and teacher talking time in one teaching period The data of the study was analyzed both quantitatively and qualitatively As for quantitative analysis, the statistics on amount of student talking ... interaction, namely, students to their teacher, students to students, and students to material In terms of the interaction between students to their teacher, students who maintain good interaction...

Ngày tải lên: 05/02/2014, 22:02

42 617 2
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

... investigate the hypoxia-mediated reduction of HO -2 expression It is tempting to speculate that the decreased heme degradation may contribute in part to the maintenance of the heme supply for hemoglobin ... (sense, 5¢-AGATCTATCCCTT GAGGCCTTGTCCGCTTG-3¢; antisense, 5¢-AAGCTTG CC GCAGGTCGCTGTCGCCTG-3¢; these contain a BglII site and a HindIII site, respectively) The genomic fragment was cloned into the BglII ... for the indicated numbers of hours Each lane contains 15 lg of total RNA The lane labeled h contained RNA prepared from untreated cells harvested just before starting the experiment At the bottom...

Ngày tải lên: 19/02/2014, 06:20

12 622 0
Tài liệu Pathophysiology and Clinical Aspects of Venous Thromboembolism in Neonates, Renal Disease and Cancer Patients Edited by Mohammed A. Abdelaal ppt

Tài liệu Pathophysiology and Clinical Aspects of Venous Thromboembolism in Neonates, Renal Disease and Cancer Patients Edited by Mohammed A. Abdelaal ppt

... tetrahydrofolate transfers into the 5,10-methyltetrahydrofolate with the enzyme 5,10-methyltetrahydrofolate reductase (MTHFR) and then into the 5methyltetrahydrofolate 5-MTHF, (Fodinger et al., 20 00) The ... cystathionine-ß-synthase, with vitamin B6 as a co-factor Another pathway of homocysteine metabolism is the re-methylation pathway, which is connected with the folate metabolic pathway (Fig 2) It involves the transfer ... represent an indication for tumours to metastasize in the absence of any other clinical evidence for metastasis A recent report states that platelet MP markedly stimulated the metastatic potential...

Ngày tải lên: 19/02/2014, 23:20

176 558 1
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

... 5¢-CAGGATCCATGACACTTCCTAGTGCG GCTCGC-3¢ and 5¢-CCAAGCTTTTATTGCTGATTAT TGGGATTCATTTGACCA-3¢ (the gene encoding the Drosophila CK2 a subunit does not contain introns in the coding region [21 ]) The ... 5¢-CAGGATCCCTATGAGCAGC TCCGAGGAAGTCTCCT-3¢ and 5¢-CTGTCGACTTA GTTTTTCGCTCGTAGTGGCATTTTAAAATTGGCT GC-3¢ BamHI–SalI digested PCR fragment was cloned into BamHI–SalI digested pAS2-1 vector, or into BamHI– ... 5¢-CTGGATCCCT ATGTCGTGTCCCAGGAGCATCGAG-3¢ and 5¢-GTC TGCAGTTAAAAATTCGGGACATTCCTTAGCCA GG-3¢ BamHI–PstI digested PCR product was cloned as a fusion with GAL4bd in the pAS2-1 vector (Clontech, La...

Ngày tải lên: 21/02/2014, 15:20

10 465 0
Báo cáo khoa học: Insights into substrate and product traffic in the Drosophila melanogaster acetylcholinesterase active site gorge by enlarging a back channel ppt

Báo cáo khoa học: Insights into substrate and product traffic in the Drosophila melanogaster acetylcholinesterase active site gorge by enlarging a back channel ppt

... entrance of acetylcholine to the CAS in the wildtype enzyme, it appears that, in the two mutants (Trp83Ala ⁄ Glu), inhibitors that bind to the PAS did not prevent the entrance of substrate into the ... we might also hypothesize that acetylcholine enters using the same path To test this hypothesis, we used two inhibitors specific for the peripheral site that bind to Trp 321 close to the entrance: ... substrate activation and inhibition in a manner consistent with the structural data [4, 12] The values of the parameters for hydrolysis of acetylthiocholine by wild-type DmAChE (Table 1) are strongly...

Ngày tải lên: 07/03/2014, 05:20

6 524 0
w