from mr moring at the blue posts temple bar

The Country Housewife and Lady''''s Director potx

The Country Housewife and Lady''''s Director potx

... salted for boiling immediately, from the Shambles From Mr J P Chymist 117 Potatoe−Puddings, made with Sweet−meats From Mr Moring, Temple Bar 118 Potatoe−Pudding baked From Mr Shepherd of Windmill−Street ... raw Beef From Mr Moring at the Blue Posts Temple Bar • Thin Beef−Collups stew'd From Oxford • Stew'd Beef−Steaks From the Spring−Gardens at Vaux−Hall, Surrey • To make Cologn's−Geneva From Cologn ... from the Shambles From Mr J P Chymist • Potatoe−Puddings, made with Sweet−meats From Mr Moring, Temple Bar • Potatoe−Pudding baked From Mr Shepherd of Windmill−Street • To make Whipt Syllabubs From...

Ngày tải lên: 31/03/2014, 16:20

130 677 0
SOUTH AFRICAN MEMORIES SOCIAL, WARLIKE & SPORTING FROM DIARIES WRITTEN AT THE TIME docx

SOUTH AFRICAN MEMORIES SOCIAL, WARLIKE & SPORTING FROM DIARIES WRITTEN AT THE TIME docx

... shoot down the leaders of the Raid, as they stood, in the market-square at Krugersdorp The state of the Boer Government at that time added to the President's difficulties He was hampered by the narrowest—minded ... FOOTNOTES: [3] Died at Groot Schuurr in September, 1905 CHAPTER III THE IMMEDIATE RESULTS OF THE RAID THE RAIDERS THEMSELVES "The fly sat on the axle-tree of the chariot-wheel, and said, 'What a dust I ... of their despised forces was as remarkable in its way as Jameson's forced march It was said at the time that the proclamation issued by the Government at home, repudiating the rebels, was the...

Ngày tải lên: 15/03/2014, 13:20

212 315 0
ASSESSMENT OF EXPLOSIVE DESTRUCTION TECHNOLOGIES FOR SPECIFIC MUNITIONS AT THE BLUE GRASS AND PUEBLO CHEMICAL AGENT DESTRUCTION PILOT PLANTS ppt

ASSESSMENT OF EXPLOSIVE DESTRUCTION TECHNOLOGIES FOR SPECIFIC MUNITIONS AT THE BLUE GRASS AND PUEBLO CHEMICAL AGENT DESTRUCTION PILOT PLANTS ppt

... presentation on the DAVINCH technology was received from the vendor and another on the use of the TDC at Schofield Barracks in Hawaii was received from the Army The third meeting was held at the ... for the stream entering the final particulate filtration/activated carbon adsorption unit and for the stream leaving this unit The stream at the outlet enters the atmosphere without further treatment ... and/or surrogate materials, in either the United States or other countries Whether a technology has been permitted or otherwise approved for use in the United States is another key indicator In assessing...

Ngày tải lên: 22/03/2014, 10:20

135 453 0
The research about remodeling and collecting gas from Imhoff tank at Dalat’s sewage treatment factory

The research about remodeling and collecting gas from Imhoff tank at Dalat’s sewage treatment factory

... 3.2 The results of analysis of methane concentration in the gas mixture generated from the model Table The results of analysis of methane concentration in the gas mixture generated from the model ... methods of waste water: method of gravity flowing Model is placed negative down, so the water level in the distributing hole higher than model’s water level From then, water flows from Φ 0.5cm pipes ... of methane concentration in the gas mixture generated from the model 3.2.1 Chromatograms 1st injection of the standard range RESULTS 3.1 .The result analysis quality model’s water in put and out...

Ngày tải lên: 18/11/2013, 16:38

6 434 0
Tài liệu Opportunity for All - How the American Public Benefits from Internet Access at U.S. Libraries pptx

Tài liệu Opportunity for All - How the American Public Benefits from Internet Access at U.S. Libraries pptx

... fortunate to have the enthusiastic participation of many students enrolled at the University of Washington Student volunteers from the Information School came from the undergraduate Informatics ... echoed what we heard from youth in the other field sites: When I'm at home my brother is always hovering over me trying to get at the computer even when there's another one in the other room ... survey comments that public library Internet access saves them time and frustration while they are away from home because they know that no matter where they go in the United States, they can find...

Ngày tải lên: 18/02/2014, 00:20

212 1,4K 0
Tài liệu Báo cáo khoa học: Restricted localization of proline-rich membrane anchor (PRiMA) of globular form acetylcholinesterase at the neuromuscular junctions – contribution and expression from motor neurons doc

Tài liệu Báo cáo khoa học: Restricted localization of proline-rich membrane anchor (PRiMA) of globular form acetylcholinesterase at the neuromuscular junctions – contribution and expression from motor neurons doc

... showing the lumbar region of the spinal cord (left) The dorsal horn and ventral horn are indicated The right panel shows PRiMA staining in the lumbar region on the same scale at low magnification The ... The mRNA level of PRiMA I was up-regulated gradually in the early postnatal stages and dramatically in the adult stage (Fig 2B) Meanwhile, the level of AChET mRNA increased gradually from the ... contribution of the motor neuron to PRiMA-linked G4 AChE at NMJs, we analyzed the effect of denervation on the localization of PRiMA The NMJs of the denervated tibialis and sham-operated muscle were...

Ngày tải lên: 18/02/2014, 08:20

12 488 0
Tài liệu Báo cáo khoa học: Critical roles of Asp40 at the haem proximal side of haem-regulated phosphodiesterase from Escherichia coli in redox potential, auto-oxidation and catalytic control doc

Tài liệu Báo cáo khoa học: Critical roles of Asp40 at the haem proximal side of haem-regulated phosphodiesterase from Escherichia coli in redox potential, auto-oxidation and catalytic control doc

... found that the mutations at Asp40 markedly altered the redox potential and auto-oxidation rate Furthermore, PDE activity was completely abolished in the Asp40 mutants To our knowledge, this is the ... the following oligonucleotides: Asp40Ala: 5¢-TGTTAATTAACGAAAATGCTGAAGTGATGTTTT TC-3¢ (forward); 3¢-GAAAAACATCACTTCAGCATTT CGTTAATTAAC-5¢ (reverse); Asp40Asn: 5¢-GGTGTT AATTAACGAAAATAACGAAGTGATGTTTTTCA ... ensure that the appropriate temperature of the solution was maintained, the reaction mixture was incubated for 10 prior to spectroscopic measurements Titration experiments were repeated at least...

Ngày tải lên: 19/02/2014, 16:20

6 424 0
Excerpt from the Examination Regulations for the Master’s Program in Economics at the University of Mannheim docx

Excerpt from the Examination Regulations for the Master’s Program in Economics at the University of Mannheim docx

... obtained This statement will also contain the information that the candidate ultimately failed the master’s exam Closing provisions Invalidity of the master’s examination If the candidate cheats during ... obtained The binding regulations regarding the composition of these credits can be found in the attachments and The program is ultimately failed if any re-take is failed at the latest possible date ... courses in the specialization phase -7- Exerpt: Examination Regulations MSc Economics the master’s thesis The core courses and regulations concerning the elective courses can be found in the attachments...

Ngày tải lên: 08/03/2014, 05:20

15 496 1
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx

Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx

... (Table 2) The high rate constant for the dissociation of O2 from the L99F mutant compared with the other proteins along with the high rate of autooxidation explains why we did not monitor the stable ... for the Leu99 and Leu115 mutants of Ec DosH are in the opposite direction from the Asp40 mutants, suggesting that the effects of mutations on the redox potential at the distal side differ from ... on the heme proximal side and ⁄ or the bond length between the heme iron and the proximal ligand may contribute to the formation of the 5-coordinated NO–heme complex We therefore speculate that...

Ngày tải lên: 16/03/2014, 13:20

14 390 0
Báo cáo khoa học: Oxygen control of nif gene expression in Klebsiella pneumoniae depends on NifL reduction at the cytoplasmic membrane by electrons derived from the reduced quinone pool doc

Báo cáo khoa học: Oxygen control of nif gene expression in Klebsiella pneumoniae depends on NifL reduction at the cytoplasmic membrane by electrons derived from the reduced quinone pool doc

... obtained in chlorate resistant mutants that not respire in the presence of nitrate, it is nitrate respiration, rather than nitrate per se, that abolishes nif expression [37,42] It appears that during ... reduce the FAD cofactor of purified NifL in the absence of a redox mediator (Fig 4) Taken together, these data indicate strongly that under anaerobic conditions and at a favourable quinol/quinone ratio, ... induction (Table 3) The finding that nif induction is not affected by nitrate indicates that the presence of nitrate per se, that might also potentially serve as an alternative nitrogen source,...

Ngày tải lên: 17/03/2014, 10:20

12 489 0
Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf

Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf

... generated using CLUSTALW The most likely candidate for the catalytic glutamate of propionate CoAtransferase based on these data was glutamate 324 (Fig 3) Detection of glutamate 324 as the catalytic ... allowed the identi®cation of the active site carboxylate The predicted derivatives were located exclusively on glutamate 324, which led us to conclude that this residue is the active site carboxylate ... preparation These data indicated that a small but signi®cant fraction of the puri®ed CoA-transferase was trapped as the enzyme-CoA thiol ester intermediate It has been Site-speci®c label of the catalytic...

Ngày tải lên: 17/03/2014, 17:20

9 499 0
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

... where they mature before migrating to the bone marrow [34,35] Definitive hematopoiesis is initiated in the aortic endothelium region of the embryonic AGM, where blood cells emerge into the aortic ... hemogenic endothelium state, and the second started at day 14, together with expression of the definitive hematopoietic marker CD45, and was coincident with observation of the first colonies in hematopoietic ... Bhatia’s group identified a population of human cells derived from hESCs that were hypothesized to be the in vitro human equivalent of the hemangioblast, characterized by expression of the endothelial...

Ngày tải lên: 22/03/2014, 17:20

12 550 0
Báo cáo khoa học: Examining multiprotein signaling complexes from all angles The use of complementary techniques to characterize complex formation at the adapter protein, linker for activation of T cells pdf

Báo cáo khoa học: Examining multiprotein signaling complexes from all angles The use of complementary techniques to characterize complex formation at the adapter protein, linker for activation of T cells pdf

... information on the composition of the multiprotein signaling complexes that occur at LAT and how these complexes facilitate the direct and indirect association of signaling proteins to LAT These ... populations, the maturation of B cells and the activation of mast cells by the FceR1 receptor These investigations have given unique insight into the functional consequences of complex formation at ... directly or indirectly associate with LAT is still controversial The result of the formation of LAT-mediated complexes is the activation of signaling pathways and the induction of effector functions...

Ngày tải lên: 23/03/2014, 15:21

10 458 0
TEACHING WRITING USING PICTURE STORIES AS TOOLS AT THE HIGH SCHOOL LEVEL: THE MOVEMENT FROM OTHER REGULATION TO SELF REGULATION doc

TEACHING WRITING USING PICTURE STORIES AS TOOLS AT THE HIGH SCHOOL LEVEL: THE MOVEMENT FROM OTHER REGULATION TO SELF REGULATION doc

... Tools at the High School Level: The Movement from Other Regulation to Self-Regulation – M.Phil Dissertation 27 1.8 Scope of the Study The study attempts to teach writing in L2 at class ... Tools at the High School Level: The Movement from Other Regulation to Self-Regulation – M.Phil Dissertation 42 writing tasks that lead students to pay attention to organization, while they ... as tools to stimulate the creative and imaginative faculties of the learners thereby activating their language use potential Such a study is justified in the sense that innovative pedagogical...

Ngày tải lên: 24/03/2014, 19:20

261 642 1
Báo cáo khoa học: From functional genomics to systems biology Meeting report based on the presentations at the 3rd EMBL Biennial Symposium 2006 (Heidelberg, Germany) Sergii Ivakhno pot

Báo cáo khoa học: From functional genomics to systems biology Meeting report based on the presentations at the 3rd EMBL Biennial Symposium 2006 (Heidelberg, Germany) Sergii Ivakhno pot

... yeast, in which the regulatory elements occur upstream of the genes that they regulate, in the human genome they are widely dispersed and occur between and within intones, making them very hard ... analyze information flow in Drosophila signal-transduction pathways One of the key considerations in such screens is the choice of appropriate read-out assays that can accurately assess the effect ... be the first successful systems biology ⁄ functional genomics application for diagnosis and treatment of patients with cancer Another important trend that was noticeable at the symposium was the...

Ngày tải lên: 30/03/2014, 09:20

10 479 1
Báo cáo khoa học: Kinetics of the quinone binding reaction at the QB site of reaction centers from the purple bacteria Rhodobacter sphaeroides reconstituted in liposomes docx

Báo cáo khoa học: Kinetics of the quinone binding reaction at the QB site of reaction centers from the purple bacteria Rhodobacter sphaeroides reconstituted in liposomes docx

... are the decay velocity and the decay the charge separated state that is generated in the RC velocity distribution, respectively) The ratio C/B repfollowing the absorption of a photon in the absence ... that the ligand in the binding 53 result larger than the same rate for the oxidized form: (kout)QH2 ‡ (kout)Q Conversely, from the hypothesis that channel, either taken up or released, moves at ... ratio d, liposomes; s, detergent decay constant depends both on the rate ratio between the quinone exchange and the charge recombination from the states D+QA– or D+QA–QB, in addition to Q/RC The...

Ngày tải lên: 30/03/2014, 20:20

11 365 0
báo cáo sinh học:" Recent changes in human resources for health and health facilities at the district level in Indonesia: evidence from 3 districts in Java" doc

báo cáo sinh học:" Recent changes in human resources for health and health facilities at the district level in Indonesia: evidence from 3 districts in Java" doc

... staff, the item that, under Indonesia’s decentralization, has first call on the general allocation fund from the central government Thus, in the absence of a matching increase in the general allocation ... districts, the outcome of a national policy, are likely to be indicative of what happened across the nation They have important implications for the sector as a whole in terms of funding, decentralization, ... (RSB)) Maternity clinic (Rumah Bersalin (RB)) Maternity clinic (Rumah Bersalin (RB)) Health center (Pusat Kesehatan Masyarakat (Puskesmas)) 0 15 19 62 62 Health center (Pusat Kesehatan Masyarakat...

Ngày tải lên: 18/06/2014, 17:20

6 433 7
Báo cáo lâm nghiệp: "ree nutrition of Norway spruce as modified by liming and experimental acidification at the Höglwald site, Germany, from 1982 to 2004" pdf

Báo cáo lâm nghiệp: "ree nutrition of Norway spruce as modified by liming and experimental acidification at the Höglwald site, Germany, from 1982 to 2004" pdf

... 80%), but the pH values are extremely low with a minimum in the Oh horizon of 2.75 (KCl) The base saturation in the A horizon (040 cm) is only 510%, and the Al saturation is high (8090%) The pH ... for lower P concentrations on the limed treatments for the C+2 and C+1, but not for the C needles K showed very high variation between years (Fig 3) The level varied from the categories very low ... No treatment eect could be observed during the whole investigation period Ca concentrations reached from low to high on the unlimed treatments and from average to very high on the limed treatments...

Ngày tải lên: 07/08/2014, 16:20

9 286 0
Báo cáo y học: "Characterization of an H3N2 triple reassortant influenza virus with a mutation at the receptor binding domain (D190A) that occurred upon virus transmission from turkeys to pigs" potx

Báo cáo y học: "Characterization of an H3N2 triple reassortant influenza virus with a mutation at the receptor binding domain (D190A) that occurred upon virus transmission from turkeys to pigs" potx

... assume that Ala at the corresponding position (Figure 1) might not affect the configuration, but rather the charge at RBD, explaining in part the above observed results Hence, viruses with Ala at residue ... preparations (PMP) were coated into 96-well plate (Costar, Lowell, MA) at concentration of 25 μg/ml overnight at 4°C Plates were rinsed with PBS and then blocked with 0.2% BSA in PBS for hours at ... Ala mutation at residue 190 of the RBD The 3D structure of the HA molecule was downloaded from Protein Data Bank webpage (http://www.pdb.org; 1HGG-A/Aichi/2/68 (H3)) and modified using the PYMOL...

Ngày tải lên: 12/08/2014, 01:22

7 512 0
báo cáo khoa học: " The PTI1-like kinase ZmPti1a from maize (Zea mays L.) co-localizes with callose at the plasma membrane of pollen and facilitates a competitive advantage to the male gametophyte" doc

báo cáo khoa học: " The PTI1-like kinase ZmPti1a from maize (Zea mays L.) co-localizes with callose at the plasma membrane of pollen and facilitates a competitive advantage to the male gametophyte" doc

... association with the generative cell until the end of stage IV When callose disappeared after the end of stage IV, neither the generative cell nor the two sperm cells during further pollen maturation ... reached the pollen wall, thus completely separating the generative nucleus from the vegetative nucleus (Fig stage I; A, B) During the time interval when the generative cell abuts against the wall, ... (dba) and anthesis (Fig 4A) Even higher transcript amounts were detected in isolated mature pollen harvested at anthesis Since mature pollen and staminate spikelets at anthesis are at the same developmental...

Ngày tải lên: 12/08/2014, 05:20

22 321 0
w