floatless level switch 61f g ap

Floatless Level Controller 61F ppsx

Floatless Level Controller 61F ppsx

... failure. Item General-purpose Controller 61F- G1 P 61F- G2 P 61F- IP Long-distance Controllers 61F- G1 PL 61F- G2 PL 61F- IPL (see note 2) High-sensitivity Controllers 61F- G1 PH 61F- G2 PH 61f- IPH (see ... Model 61F- G (Pages 6 to 10, 54) Compact Plug-in Model 61F- GP-N (Pages 20 to 22, 55) 61F- GP-N8 (Pa g es 23 to 26, 55) 61F- GPN-BT/BC (Pages 18 to 19) Standard Model Plug-in Model 61F- G1 (Pa g es ... 5P Connecting nut Approx. 20 g 3 4 5 Weight Approx. 50 g 3 to 4 4 to 6 5 to 8 End cap Approx. 1 g 3 4 5 Insulation Cap Approx. 10 g 2 3 4 Adhesive Approx. 5 g 1 1 1 Electrode Band weight (1m) Approx....

Ngày tải lên: 06/07/2014, 13:20

76 534 0
Báo cáo y học: "High level expression of apoptosis inhibitor in hepatoma cell line expressing Hepatitis

Báo cáo y học: "High level expression of apoptosis inhibitor in hepatoma cell line expressing Hepatitis

... 3’-CATAGCATTATCCTTCGGTTC (API2) were used to detect cIAP2. Primers with the sequence 3’-GGGAAGCAGAGATCATTTTGC (API3) and 3’- AACTGAGTATATCCATGTCCC (API4) were used to detect XIAP. PCR bands were ... using RT-PCR kit (Stratagene, La Jolla, CA, USA), following by PCR amplification as described in our paper [22]. The primers with the sequence 3’-GAGGAGACAGTCCTACTGAAA (API1) and 3’-CATAGCATTATCCTTCGGTTC ... viruses through the HBV genome integrated in the cell chromosome [1, 34, 35]. The results from gene array suggest that the expression of cIAP1 and cIAP2 genes was obviously higher in the HepG2.215...

Ngày tải lên: 02/11/2012, 11:17

6 514 0
Application - Level Proxies

Application - Level Proxies

... WinGate. By running through someone else's proxy server, a hacker can launder their IP address and keep from being found. If they're caught hacking, the IP address shows up in logs as ... layer routing between networks. ã Proxies provide a single point of access, control, and logging. Each of these security advantages is detailed in the following sections. Client Hiding The major ... using the− firewalling features of BSD or Linux along with separate proxy packages such as Jigsaw in this manner. 152 URL blocked database.− Sage Advice: Don't Make Me URL When you're...

Ngày tải lên: 29/09/2013, 13:20

15 567 0
Switch Level Modeling part 1

Switch Level Modeling part 1

... signal strengths. Refer to Appendix A , Strength Modeling and Advanced Net Definitions, for strength levels in Verilog. ã Resistive devices have a high source-to-drain impedance. Regular switches ... impedance. ã Resistive switches reduce signal strengths when signals pass through them. The changes are shown below. Regular switches retain strength levels of signals from input to out put. ... corresponding resistive devices. Resistive switches have higher source-to-drain impedance than regular switches and reduce the strength of signals passing through them. Resistive switches are...

Ngày tải lên: 20/10/2013, 16:15

7 341 0
Switch Level Modeling part 2

Switch Level Modeling part 2

... digital circuits, using switch -level constructs. 11.2.1 CMOS Nor Gate Though Verilog has a nor gate primitive, let us design our own nor gate,using CMOS switches. The gate and the switch -level ... circuit diagram for the nor gate are shown in Figure 11-4 . Figure 11-4. Gate and Switch Diagram for Nor Gate Using the switch primitives discussed in Section 11.1 , Switch- Modeling Elements, ... inverter my_not by using switches. We can write the Verilog module description for the CMOS inverter from the switch -level circuit diagram in Figure 11-7 . The Verilog description of the inverter...

Ngày tải lên: 20/10/2013, 16:15

6 335 0
Tài liệu Appendix G: Glossary ppt

Tài liệu Appendix G: Glossary ppt

... Advanced Business Application Programming. ABAP is a fourth-generation programming language developed by SAP for application development purposes. ABAP Query ABAP Workbench tool that allows users ... the following options:  Synchronous update (V1 update) Report Development Tools G 1 Appendix G: Glossary G Appendix G: Glossary Reporting Made Easy G 4 BW SAP Business ... selecting menu options, function keys or pushbuttons, or pointing to icons with the mouse. Appendix G: Glossary Reporting Made Easy G 8 InfoPackage Group InfoPackages that logically...

Ngày tải lên: 21/12/2013, 19:15

14 280 0
Interval analysis  theory and applications g otz alefelda  g unter mayerb

Interval analysis theory and applications g otz alefelda g unter mayerb

... Thesis, Universitat Freiburg, Freiburg, 1990. [32] A. Gienger, Zur Losungsveriÿkation bei Fredholmschen Integralgleichungen zweiter Art, Thesis, Universitat Karlsruhe, Karlsruhe, 1997. [33] G. H. Golub, C.F. ... several pro- gramming languages. The extended scientiÿc computation (XSC) languages provide powerful tools necessary for achieving high accuracy and reliability. They provide a large number of ... nichtselbstadjungierter Eigenwertprobleme und ihre Anwendung auf die Orr-Sommerfeld-Gleichung, Thesis, Universitat Karlsruhe, Karlsruhe, 1999. [52] B. Lang, Lokalisierung und Darstellung von Nullstellenmengen einer...

Ngày tải lên: 12/01/2014, 22:05

44 479 0
Slide an investigation into some approaches to vocabulary teaching and learning and the application of games in teaching and learning vocabulary at pre – intermediate level at foreign language center – haiphong university

Slide an investigation into some approaches to vocabulary teaching and learning and the application of games in teaching and learning vocabulary at pre – intermediate level at foreign language center – haiphong university

... in language teaching and Vocabulary in language teaching and learning learning 1.2.1. A neglect aspect of foreign language 1.2.1. A neglect aspect of foreign language methodology methodology 1.2.2. ... Vocabulary in language teaching and learning 1.2. Vocabulary in language teaching and learning 1.3. Approaches to language teaching and their 1.3. Approaches to language teaching and their relevance ... learning vocabulary teaching and learning  Games can motivate learners by bringing Games can motivate learners by bringing fun to classes fun to classes  Games can provide language practice Games...

Ngày tải lên: 29/01/2014, 14:36

29 1,4K 2

Bạn có muốn tìm thêm với từ khóa:

w