excessive wear of the ways of a cold deformation processing machine

Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

... pTrc9 9A vector was used for cloning and overexpression of era, encoding the GTPase Era The primers used were as follows: era_F_NcoI, CGACCATGGCGAAC AGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGA CAGCCTTCCATCGGAGTTACT ... 10% of the value The figure is generated by the use of FYTIK software from raw data with a representative gradient profile was a decrease in the total amount of ribosomal particles (30S, 50S, and ... of marker lane products are given in (A) The tables below (A) and (C) show quantification of extension products for each corresponding panel calculated by IMAGE analysis software the strain was...

Ngày tải lên: 06/03/2014, 00:21

12 439 0
Báo cáo khoa học: Structural features and dynamics of a cold-adapted alkaline phosphatase studied by EPR spectroscopy docx

Báo cáo khoa học: Structural features and dynamics of a cold-adapted alkaline phosphatase studied by EPR spectroscopy docx

... in these areas We also chose to place The activity and stability of the Vibrio AP was measured for each mutation, before and after spinlabeling Furthermore, the activity and stability of the ... activity in the standard assay and EPR spectra of the spin-labeled WT AP were measured after incubation in urea The scaled mobility factor (Ms) was calculated from the central linewidth of the EPR ... [38,39] The DH0)1 parameter gives an indication about movement of the point where the spin-label attaches to the backbone of the polypeptide, whereas )1 the parameter also gives a measure of the...

Ngày tải lên: 16/03/2014, 01:20

11 280 0
Báo cáo khoa học: Crystal structure of a cold-adapted class C b-lactamase potx

Báo cáo khoa học: Crystal structure of a cold-adapted class C b-lactamase potx

... Glu272–Arg148 21 19 14 092 8248 5844 –1 6.5 No of hydrogen bonds (side chain–side chain) Aromatic stacking ˚ ASA total (A2 ) ˚ ASA apolar (A2 ) ˚ ASA polar (A2 ) Formal global charge Theoretical pIb ... pattern of the known class C b-lactamases structures, with an all -a domain and an a ⁄ b domain with the active site Ser64 located in a depression between the two domains at the N-terminus of the a2 ... for the TAE4 b-lactamase and compared with those of the enzymes from Psy immobilis, E cloacae 908R and S marcescens (Table 1) The substrate profile of the TAE4 b-lactamase is globally similar to...

Ngày tải lên: 23/03/2014, 07:20

11 341 0
Báo cáo hóa học: "Design of Experiments for Performance Evaluation and Parameter Tuning of a Road Image Processing Chain" ppt

Báo cáo hóa học: "Design of Experiments for Performance Evaluation and Parameter Tuning of a Road Image Processing Chain" ppt

... to the optimal tuning parameter for each particular image These two steps are described in the following paragraphs Image processing chain as a black box Effects (evaluation criteria for IPC outputs) ... that tuning only one parameter at a time can not lead to an optimal setting as some parameters may be interdependent Hence, the goal is to identify which of the parameters are really significant ... descriptors are relevant for the tuning purpose, the neural network should converge The other part of the image database is reserved for the test of the neural network The performance of the tuning...

Ngày tải lên: 22/06/2014, 23:20

10 461 0
Computational analysis of a permanent magnet synchronous machine using numerical techniques

Computational analysis of a permanent magnet synchronous machine using numerical techniques

... Most available type of machines can be analyzed using a circuit model once the machine parameters are known The main limitation of this method is that accurate determination of necessary parameters ... Configurations of BLDC Machine (a) (b) Figure 1.3: Typical Configurations of (a) A DC Machine (b) A PM DC Machine 1.2 Permanent Magnet Materials The most distinguishing part of a permanent magnet machine ... suitable for the electromagnetic field analysis of permanent magnet machines There are a number of numerical methods available for the analysis of electromagnetic field problems A few of them are,...

Ngày tải lên: 15/09/2015, 22:17

285 991 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper primer Fig Partial alignment of alkaline phosphatases at ... higher than the native cold adapted enzyme (Table 1) The mutant G26 1A/ Y26 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation of mutant and wild-type...

Ngày tải lên: 22/02/2014, 04:20

6 489 0
Ten Ways to Improve the Security of a New Computer doc

Ten Ways to Improve the Security of a New Computer doc

... programs offer automatic updating Enable that feature so your software always has the most current signatures If automatic updates aren’t offered, be sure to install the software from a reputable ... Antispyware Software Installing an antivirus and antispyware software program and keeping it up to date is a critical step in protecting your computer Many types of antivirus and antispyware software ... these features before disabling or modifying them The AutoRun feature in Microsoft Windows systems was a default feature at the time of the Conficker malware and was one of the three ways computers...

Ngày tải lên: 14/03/2014, 22:20

5 621 0
Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot

Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot

... between Arg56 and the O2 of the nucleobase However, after evaluating both crystal structures we conclude that the alternative orientation of the base and sugar–phosphate backbone of the nucleotide ... that the first three b strands may form association interfaces that promote aggregate growth In the late stage of amyloid formation, signals from the N-terminal half of the molecules (equivalent ... single-stranded RNA recognition Acc Chem Res 37, 279– 287 Schroder K, Graumann P, Schnuchel A, Holak TA & Marahiel MA (1995) Mutational analysis of the putative nucleic acid-binding surface of the cold- shock...

Ngày tải lên: 23/03/2014, 09:21

15 333 0
Báo cáo y học: "Cold saline irrigation of the renal pelvis during Radiofrequency Ablation of a central renal neoplasm: a case report" potx

Báo cáo y học: "Cold saline irrigation of the renal pelvis during Radiofrequency Ablation of a central renal neoplasm: a case report" potx

... 76(4):297-300 Hiraki T, Yasui K, Mimura H, Gobara H, Mukai T, Hase S, Fujiwara H, Tajiri N, Naomoto Y, Yamatsuji T, Shirakawa Y, Asami S, Nakatsuka H, Hanazaki M, Morita K, Tanaka N, Kanazawa S: Radiofrequency ... renal RFA [2] Some authors have managed to increase ablation diameters by reducing blood flow to the treated area using embolization or clamping of the renal artery [6] The use and efficacy of ... guidance and its tip advanced to the right renal pelvis (Fig 2) A Foley 14 F urethral catheter was inserted in the bladder and attached to a drainage bag This system was used to irrigate the renal...

Ngày tải lên: 11/08/2014, 11:20

4 264 0
The Design and Implementation of a Log-Structured File System

The Design and Implementation of a Log-Structured File System

... purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database ... log as the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is reserved ... modeled The simulator runs until all clean segments are exhausted, then simulates the actions of a cleaner until a threshold number of clean segments is available again In each run the simulator was...

Ngày tải lên: 12/09/2012, 15:05

15 1,4K 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... for another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all of the necessary data is available, may use a separate thread to copy that data ... object data It is usually made in response to a pager_data_request call made to the data manager by the kernel Typical data managers will only provide data upon demand (when processing pager_data_request...

Ngày tải lên: 12/09/2012, 15:05

23 1,3K 1
List the components of a radio system

List the components of a radio system

... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of ... Divides the transmission time into several slots – Each user is assigned the entire frequency for the transmission • For a fraction of time on a fixed, rotating basis – Advantages • Uses the bandwidth...

Ngày tải lên: 13/09/2012, 10:52

30 922 0
Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf

Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf

... languages belonged to a third, Nilo-Saharan family, which may have originated in the broad Saharan region at least as early as Afroasiatic Nilo-Saharan may be distantly related to the fourth family, ... taken Carthage a decade later, and extended their power across the region sub-saharan africa Whether Carthage transmitted metalworking to sub-Saharan Africa is one of the mysteries of African ... religions, and alphabetic literacy that sub-Saharan Africa partially shared with the Eurasian core Partial isolation meant that cultural phenomena took distinctively African forms Partial integration...

Ngày tải lên: 21/09/2012, 10:39

386 1,2K 4
Guest the meaning of a word

Guest the meaning of a word

... (not, reversal) ex- (out of, former) pre- (before) re- (again, restore) un- (do the opposite of) ad- (to, toward) com-, con-, co- (with, together) en-, em- (in, into, to cover or contain) in- (into, ... (with, together) en-, em- (in, into, to cover or contain) in- (into, not) pro- (in favor of, before) sub- (under, beneath) ...

Ngày tải lên: 02/10/2012, 12:07

2 874 1
Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

... Information access and management is an area of great activity, given the rise in popularity of the Internet and the explosion of data available to users It is the application area that this thesis ... standards JAVA itself is not an agent-application Yet, the Java Agent Template is available which "provides basic agent functionality packaged as a Java application This agent can be executed as ... of information that have changed rapidly in the last few years are the amount that it is available in, the number of sources and the ease with which it can be obtained Expectations are that these...

Ngày tải lên: 08/10/2012, 15:22

100 811 3
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11] This is a quasi-experimental...

Ngày tải lên: 25/10/2012, 11:00

6 693 0
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk

Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk

... patients with symptomatic coronary artery disease has been examined in the first four trials of the ongoing ENDEAVOR clinical trials program The results of these initial trials indicate that the ... the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary artery disease (CAD; 4) Also the safety and efficacy of Paclitaxel-eluting ... mg) to achieve maximal vasodilatation before undergoing their initial and final angiograms The glycoprotein IIb/IIIa inhibitor (Tirofiban) was administered at the operator’s discretion All patients...

Ngày tải lên: 25/10/2012, 11:18

6 550 0
The Marketing Strategy of a multinational join stock company.doc

The Marketing Strategy of a multinational join stock company.doc

... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... Marketing Strategy of a multinational join stock company multinational join stock company has a certain advantage: a multinational join stock company has always kept its prices as competitive as possible ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer of the book The Silk Road to International Marketing” had...

Ngày tải lên: 27/10/2012, 16:51

25 624 8
 Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)

Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)

... to an amplitude histogram, which generates a large inventory of normalized mathematical indexes of abnormality It is the pattern of these mathematical indexes of abnormality, obtained from analysis ... resulting mathematically integrated patterns of the abnormal indexes are then compared for their degree of abnormality to the abnormal index patterns in the reference database to reach a final diagnostic ... in the included trials and were analyzed using the same software and hardware located at the central server location in New York All MCG analyses in this database have been validated against the...

Ngày tải lên: 03/11/2012, 10:58

13 684 0
w