error interaction and development of safety critical systems

Investigation of laser carbon nanotubes interaction and development of CNT based devices

Investigation of laser carbon nanotubes interaction and development of CNT based devices

... analysis of the Raman spectroscopy and characterization of single-walled CNTs The ratio of G-band to D-band intensities can be used as an indicator for the purity of CNTs The lower the D-band compared ... etching [19] and filling [20] of CNTs, magnetic measurements [21,22], purification of CNTs [23] and etc Recent developments and potential applications of CNTs are extensive and will be discussed in ... electronic band structure of the CNT which is in turn dependent on the particular diameter and chirality PL thus serves as a direct optical probe of the electronic band structure and structure of single-walled...

Ngày tải lên: 11/09/2015, 10:05

139 235 0
Structural analysis and deployable development of cable strut systems

Structural analysis and deployable development of cable strut systems

... Majowiecki and Ossola1989; Otto and Schleyer, 1969) has generated three kinds of roof systems which are formed by cable, strut and the combination of the two Cable net is formed by only cables and belongs ... stabilizing procedure than existing systems Various types of cable strut systems are investigated and generally classified into two categories: tension and free standing systems For the first category, ... STRUCTURAL ANALYSIS AND DEPLOYABLE DEVELOPMENT OF CABLE STRUT SYSTEMS SONG JIANHONG (B.Eng Xi’an Jiao Tong University) A THESIS SUBMITTED FOR THE DEGREE OF DOCTER OF PHILOSOPHY DEPARTMENT OF CIVIL ENGINEERING...

Ngày tải lên: 14/09/2015, 12:50

289 482 0
Design and development of major balance of plant components in solid oxide fuel cell system

Design and development of major balance of plant components in solid oxide fuel cell system

... any SOFC system, the performance of the INER SOFC system is dependent not only on the design and operating conditions of the fuel cell stack, but also on the design and operating conditions of ... provided by the anode off-gas given an anode off-gas temperature of less than 650 oC, a cathode off-gas temperature of less than 390 oC, and a flame barrier temperature of less than 700 oC However, ... SOFC BOP system (S/C=1.7, O/C=0.3, fuel utilization = 64.2%, electrical conversion efficiency = 44%) Design of SOFC BOP components The BOP components of a SOFC system account for between 50% and...

Ngày tải lên: 05/09/2013, 16:10

12 586 0
Analysis and control of nonlinear process systems

Analysis and control of nonlinear process systems

... information engineers at the University of Veszpr´m, Hungary since 2003 e TLFeBook Basic Notions of Systems and Signals Signals and systems are basic notions of systems and control theory Therefore, we ... Concepts and Designs K.F Man, K.S Tang and S Kwong Neural Networks for Modelling and Control of Dynamic Systems M Nørgaard, O Ravn, N.K Poulsen and L.K Hansen Modelling and Control of Robot Manipulators ... Printed and bound in the United States of America 69/3830-543210 Printed on acid-free paper SPIN 10868248 TLFeBook For God had not given us the spirit of fear; but of power, and of love, and of a...

Ngày tải lên: 01/01/2014, 18:38

335 375 1
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... between yeast and mammalian GPCR signaling pathways, this assay enables the quantitative measurement of receptor activity, or alternately the detection of its ligands Using known ligands of I7 OR ... related ligands strongly suggests the authenticity of its ligand binding and the maintenance of the coding ability at the receptor level Consequently this suggests that glycosylation of I7 OR is ... TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of the new insert, as in the case of pJH2-I7 Plasmids pJH2-I7 and pJH2-OR17-40...

Ngày tải lên: 07/03/2014, 16:20

14 473 0
THE STRUCTURE AND DEVELOPMENT OF THE CEREAL PLANT pptx

THE STRUCTURE AND DEVELOPMENT OF THE CEREAL PLANT pptx

... AND DEVELOPMENT OF THE CEREAL PLANT 24 THE WHEAT BOOK THE WHEAT BOOK CHAPTER – THE STRUCTURE AND DEVELOPMENT OF THE CEREAL PLANT THE STRUCTURE AND DEVELOPMENT OF THE CEREAL PLANT Tim Setter and ... formation of florets within each spikelet and, later, the regression and death of some florets and spikelets and the death of some tillers This phase is also the time of greatest dry mass increase and ... Mainstem and tillers 26: Mainstem and tillers 27: Mainstem and tillers 28: Mainstem and tillers 29: Mainstem and or more tillers Dough development Kernel no longer watery but still soft and dough-like...

Ngày tải lên: 08/03/2014, 23:20

86 710 0
Origin and Development of Commercial and Islamic Banking Operations pot

Origin and Development of Commercial and Islamic Banking Operations pot

... BC) of Lydia They were of electrum Origin and Development of Commercial and Islamic Banking Operations (a mixture of gold and silver) This must have encouraged the emergence and practices of banking ... ups and downs depending on the political and military conditions of the Republic In time of wars and disorder, inflation, financial stagnation and bankruptcy prevail and in times of peace and ... inspired banking systems and business models and abandoned Islamic commercial practices With the achievement of independence, the nationalization of foreign banks and the development of national banking,...

Ngày tải lên: 22/03/2014, 21:20

23 372 0
ELECTIONS: Federal Efforts to Improve Security and Reliability of Electronic Voting Systems Are Under Way, but Key Activities Need to Be Completed doc

ELECTIONS: Federal Efforts to Improve Security and Reliability of Electronic Voting Systems Are Under Way, but Key Activities Need to Be Completed doc

... are cast and counted by one of two types of electronic voting systems: optical scan systems and direct recording electronic (DRE) systems Such systems include the hardware, software, and firmware ... standards), and we attended public meetings and interviewed officials from EAC, its Technical Guidelines Development Committee (TGDC), and the Department of Commerce’s National Institute of Standards ... chaired by the Director of the National Institute of Standards and Technology • The Standards Board brings together one state and one local official from each of the 55 states and territories to review...

Ngày tải lên: 23/03/2014, 03:20

107 394 0
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

... conjugation of the quencher and the fluorophore influenced neither the rate nor the site of hydrolysis of the peptide Sensitivity and selectivity of the Dabcyl– EVYAVES–Edans substrate and the activity of ... the development of such a substrate based on analysis of PrtA cleavage site specificity, and kinetic characterization of PrtA activity on the new substrate Results and Discussion Identification of ... samples For an exploration of the proteolytic system of PrtA, and an understanding of its role in the infection process of Photorhabdus, we needed a highly sensitive and specific substrate to selectively...

Ngày tải lên: 23/03/2014, 09:20

11 425 0
ORIGIN AND DEVELOPMENT OF FORM AND ORNAMENT IN CERAMIC ART pptx

ORIGIN AND DEVELOPMENT OF FORM AND ORNAMENT IN CERAMIC ART pptx

... painted upon pottery 463 488.—Theoretical development of fret work 464 489.—Theoretical development of scroll work 465 [Pg 443] ORIGIN AND DEVELOPMENT OF FORM AND ORNAMENT IN CERAMIC ART By William ... the shape of the vessels employed at the time of the introduction of the art, and these depend, to a great extent, upon the kind and grade of culture of the people acquiring the art and upon the ... with the use of clay and a capacity in handling it that, with advancing culture, brought all nature within the reach of the potter and made it assist in the processes of variation and development...

Ngày tải lên: 28/03/2014, 20:20

34 490 0
DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical Devices docx

DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical Devices docx

... DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical ... responsibility for the use of these circuits and/ or software or of systems incorporating these circuits and/ or software lies with the reader, who must apply for any and all approvals and certifications ... address the issue of safety in the development of electronic medical devices, bypassing the difficult math and providing lots of insider advice In Chapter we present the development of amplifiers...

Ngày tải lên: 29/03/2014, 11:20

478 528 2
MODELING AND CONTROL OF NONHOLONOMIC MECHANICAL SYSTEMS doc

MODELING AND CONTROL OF NONHOLONOMIC MECHANICAL SYSTEMS doc

... Further, denote by ri and vi , respectively, the position and the linear velocity of the center of mass, and by ωi the angular velocity of the body (all vectors are embedded in I and expressed in ... the mass of the i-th body and Ii its inertia matrix with respect to the center of mass When no external force is applied, and in the absence of gravity and dissipation forces, the linear and angular ... Laumond [40] has devised a cleverly organized proof of controllability and hence, of complete nonholonomy However, the degree of nonholonomy of the system is not strictly defined, since the relative...

Ngày tải lên: 01/04/2014, 00:20

66 458 0
the design and implementation of geographic information systems

the design and implementation of geographic information systems

... results, and to provide high levels of confidence in the output.The process of design and implementation of a GIS begins with people and their needs and ends up with applications in the hands of people ... files and probably thousands of public and private documents in the hands of organizations and consulting companies that have implemented GISs But that information is very hard to come by and is ... The Design and Implementation of Geographic Information Systems The Design and Implementation of Geographic Information Systems John E Harmon and Steven J Anderson This book is printed...

Ngày tải lên: 01/06/2014, 12:38

273 1,3K 0
Báo cáo hóa học: " On the understanding and development of modern physical neurorehabilitation methods: robotics and non-invasive brain stimulation" pdf

Báo cáo hóa học: " On the understanding and development of modern physical neurorehabilitation methods: robotics and non-invasive brain stimulation" pdf

... optimally promote development and retention of motor skills and translate into long-term reduction in disability Also supporting a quantitative scientific understanding of mechanisms of post-stroke ... extend beyond orthopaedic, and impact recovery of motor control, we know that therapies cannot be passive and patients must be engaged Perhaps part of the 'magic' in the hands of the individual therapist ... disorders, and discusses current NBS plasticity protocols applied in clinical research Understanding stroke recovery This thematic series emphasizes the understanding and development of modern...

Ngày tải lên: 19/06/2014, 08:20

4 453 0
Opal''''s Site Organization and Development of Russian Business_1 docx

Opal''''s Site Organization and Development of Russian Business_1 docx

... analysis of probability to obtain financial and organizational support from the state authorities Utility of business associations and their contribution to the establishment of standards and rules of ... impacts of business integration via the formation of holding companies and other types of business groups upon corporate governance and firm performance of affiliated firms; and (c) the role and ... boards of directors, and its chairs in 2001–2004 Comparison of JSCs with separation or combination of ownership and management Logistic regressions for shareholder choice of separated ownership and...

Ngày tải lên: 20/06/2014, 20:20

23 266 0
Opal''''s Site Organization and Development of Russian Business_2 pptx

Opal''''s Site Organization and Development of Russian Business_2 pptx

... by studies of economic transition and company behavior in transition economies, with the participation of leading economists of the world, including Andrei Shleifer, Gerard Roland, and Josef Stiglitz ... were related to the compilation and approval of five-year plans and implementation of investment projects came within the competence of higher levels of government); and (c) managers were involved ... planned target volumes and resources allocated to the enterprise and with suppliers and customers on product mix and other terms of supply This pattern of behavior was typical of enterprises in all...

Ngày tải lên: 20/06/2014, 20:20

23 286 0
Opal''''s Site Organization and Development of Russian Business_3 pdf

Opal''''s Site Organization and Development of Russian Business_3 pdf

... Organization and Development of Russian Business Less than 25% of shares 13% More than 50% of shares + absence of a counterbalance 48% From 25% to 50% of shares 18% More than 50% of shares + presence of ... in lack of capacity, lower wages and profitability, and a higher risk of loss Moreover, the authors produced evidence (in a small sample of companies) of the positive role of the size of shareholding ... loans, and funds of Russian partners and other private investors A comparison of ownership structures and intensity of corporate restructuring performed by the Bureau of Economic Analysis as part of...

Ngày tải lên: 20/06/2014, 20:20

23 344 0
w