enhancement of transgene expression by ebna 1

immune mediated loss of transgene expression from virally transduced brain cells is irreversible mediated by ifn perforin and tnf and due to the elimination of transduced cells

immune mediated loss of transgene expression from virally transduced brain cells is irreversible mediated by ifn perforin and tnf and due to the elimination of transduced cells

... response reduces transgene expression in the brain through loss of transduced cells Received 28 June 2011; accepted 13 October 2011; published online 10 January 2012 doi:10.1038/mt.2011.243 Introduction ... Jeffrey M Zirger1–3, Mariana Puntel1–3, Josee Bergeron1–3, Mia Wibowo1–3, Rameen Moridzadeh1–3, Niyati Bondale1–3, Carlos Barcia1–3, Kurt M Kroeger1–3,*, Chunyan Liu1–3, Maria G Castro1–5 and Pedro ... Number of CD4 T cells and CD8+ cells/brain 75,000 150,000 * 125,000 * * 25,000 125,000 * * * 100,000 * * 10,000 7,500 75,000 * 5,000 50,000 Number of CD45+ cells/brain c 25,000 2,500 14 30 90 60 120

Ngày tải lên: 02/11/2022, 11:35

12 4 0
Báo cáo y học: "Tat RNA silencing suppressor activity contributes to perturbation of lymphocyte miRNA by HIV-1" ppsx

Báo cáo y học: "Tat RNA silencing suppressor activity contributes to perturbation of lymphocyte miRNA by HIV-1" ppsx

... HIV-1 Log 2 Mock Lo g 2 Mock 5 7 9 11 13 15 5 7 9 111315 5 7 9 111315 5 7 9 111315 5 7 9 11 13 15 5 7 9 11 13 15 A B C Figure 2 Host miRNA expression is changed by infection with HIV-1, Vif/Vpr ... HIV-1 Log 2 HIV-1 5 7 9 11 13 15 5 7 9 11 13 15 5 7 9 11 13 15 5 7 9 11 13 15 A B Figure 3 Ablation of Tat RSS alters miRNA expression trends relative to HIV-1 and Vif-/Vpr-deficient HIV-1. ... 33% 17% 17% hsa-miR-95 39% 51% 41% 12% 10% hsa-miR-99b 46% 53% 33% 7% 20% hsa-miR-100 24% 35% 19% 11% 16% hsa-miR-103 46% 53% 37% 6% 16% hsa-miR-107 42% 51% 31% 8% 20% hsa-miR-125b 16% 26% 19% 10%

Ngày tải lên: 13/08/2014, 01:20

13 290 0
Giáo trình principles of surgery 11e by schwartz 1

Giáo trình principles of surgery 11e by schwartz 1

... © 2019, 2015, 2010, 2005, 1999, 1994, 1989, 1984, 1979, 1974, 1969 by McGraw-Hill Education All rights reserved Except as permitted under the United States Copyright Act of 1976, no part of this ... Considerations 511 16 The Skin and Subcutaneous Tissue 513 Patrick Harbour and David H Song 17 The Breast .541 Catherine C Parker, Senthil Damodaran, Kirby I Bland, and Kelly K Hunt 18 Disorders of ... Shock Kirby I Bland, MD Fay Fletcher Kerner Professor The University of Alabama at Birmingham Department of Surgery Birmingham, Alabama Chapter 17, The Breast Geoffrey N Box, MD Assistant Professor

Ngày tải lên: 07/08/2019, 16:02

50 62 0
Test bank and solution of biology 11e by sylvia (1)

Test bank and solution of biology 11e by sylvia (1)

... BASIS OF LIFE The Cell Cycle and Cellular Reproduction 10 Meiosis and Sexual Reproduction 11 Mendelian Patterns of Inheritance 12 Molecular Biology of the Gene 13 Regulation of Gene Expression 14 ... ecosystem 10 The biosphere is comprised of regions of the Earth’s crust, waters, and atmosphere inhabited by organisms 11 Each level of organization is more complex than the level preceding it 12 Each ... Learning Outcomes 1.1 The Characteristics of Life Distinguish between the levels of biological organization Identify the basic characteristics of life 1.2 Evolution and the Classification of Life Distinguish

Ngày tải lên: 08/11/2019, 14:52

13 39 0
Test bank and solution of calculus 2nd by gillett (1)

Test bank and solution of calculus 2nd by gillett (1)

... 99π/4 999π/4 9999π/4 f (x) 1.4098 1.4142 1.4142 1.4142 x 1.1π/4 1.01π/4 1.001π/4 1.0001π/4 f (x) 1.4098 1.4142 1.4142 1.4142 The limit appears to be approximately 1.4142 b √ cos 2x cos2 x − sin2 ... 3/(4π)] 1.1.26 f (p2 ) = (p2 )2 − = p4 − 1.1.25 f (10) = 96 1.1.27 g(1/z) = (1/z)3 = 1.1.29 F (g(y)) = F (y ) = z3 1.1.28 F (y ) = y −3 1.1.30 f (g(w)) = f (w3 ) = (w3 )2 − = w6 − y −3 1.1.31 g(f ... 1) 1 √ = lim − √ =− x→3 16 x + 1(2 + x + 1) 1 − x+1 = lim t − 13 3t − 1 , which does not exist = lim = lim t→1/3 (3t − 1)2 t→1/3 3(3t − 1)2 t→1/3 3(3t − 1) 16 lim x4 − 81 (x − 3)(x + 3)(x2 + 9)

Ngày tải lên: 08/11/2019, 15:00

110 50 0
Test bank and solution manual of essential of economics 4e by hubbard (1)

Test bank and solution manual of essential of economics 4e by hubbard (1)

... vegetables 19) Refer to Figure 2-2 What is the opportunity cost of one pound of vegetables? A) pound of meat B) 1.2 pounds of meat C) pounds of meat D) 12 pounds of meat Answer: A Diff: Page Ref: 40-41 ... opportunity cost of one pound of meat? A) B) pound of vegetables pounds of vegetables C) 1.6 pounds of vegetables D) 16 pounds of vegetables Answer: B Diff: Page Ref: 40-41 Topic: Opportunity Cost ... to produce 120 pounds of meat, how much vegetables can it produce to maximize production? A) pounds of vegetables B) 60 pounds of vegetables C) 100 pounds of vegetables D) 160 pounds of vegetables

Ngày tải lên: 21/11/2019, 17:13

194 42 0
Test bank and solution manual of essential of marketing research by malhotra (1)

Test bank and solution manual of essential of marketing research by malhotra (1)

... thinking Objective: 11 Copyright © 2015 Pearson Education, Inc 61) Which of the following is true about secondary data? A) Collection time is long B) Quality of data is high C) Cost of collecting ... Examples of this type of problem include the determination of the effectiveness of the current advertising campaign and the determination of the impact on sales and problems of various levels of price ... Specification of information needed is one of the components of the approach to the problem Answer: TRUE Diff: AACSB: Application of knowledge Objective: 38) By focusing on each component of the problem,

Ngày tải lên: 21/11/2019, 17:13

23 34 0
Test bank and solution manual of essential of economics 4e by hubbard (1)

Test bank and solution manual of essential of economics 4e by hubbard (1)

... vegetables 19) Refer to Figure 2-2 What is the opportunity cost of one pound of vegetables? A) pound of meat B) 1.2 pounds of meat C) pounds of meat D) 12 pounds of meat Answer: A Diff: Page Ref: 40-41 ... opportunity cost of one pound of meat? A) B) pound of vegetables pounds of vegetables C) 1.6 pounds of vegetables D) 16 pounds of vegetables Answer: B Diff: Page Ref: 40-41 Topic: Opportunity Cost ... to produce 120 pounds of meat, how much vegetables can it produce to maximize production? A) pounds of vegetables B) 60 pounds of vegetables C) 100 pounds of vegetables D) 160 pounds of vegetables

Ngày tải lên: 31/01/2020, 14:18

194 48 0
Test bank and solution of calculus 2nd by gillett (1)

Test bank and solution of calculus 2nd by gillett (1)

... 99π/4 999π/4 9999π/4 f (x) 1.4098 1.4142 1.4142 1.4142 x 1.1π/4 1.01π/4 1.001π/4 1.0001π/4 f (x) 1.4098 1.4142 1.4142 1.4142 The limit appears to be approximately 1.4142 b √ cos 2x cos2 x − sin2 ... 3/(4π)] 1.1.26 f (p2 ) = (p2 )2 − = p4 − 1.1.25 f (10) = 96 1.1.27 g(1/z) = (1/z)3 = 1.1.29 F (g(y)) = F (y ) = z3 1.1.28 F (y ) = y −3 1.1.30 f (g(w)) = f (w3 ) = (w3 )2 − = w6 − y −3 1.1.31 g(f ... 1) 1 √ = lim − √ =− x→3 16 x + 1(2 + x + 1) 1 − x+1 = lim t − 13 3t − 1 , which does not exist = lim = lim t→1/3 (3t − 1)2 t→1/3 3(3t − 1)2 t→1/3 3(3t − 1) 16 lim x4 − 81 (x − 3)(x + 3)(x2 + 9)

Ngày tải lên: 31/01/2020, 14:18

110 19 0
Test bank and solution of biology 11e by sylvia (1)

Test bank and solution of biology 11e by sylvia (1)

... BASIS OF LIFE The Cell Cycle and Cellular Reproduction 10 Meiosis and Sexual Reproduction 11 Mendelian Patterns of Inheritance 12 Molecular Biology of the Gene 13 Regulation of Gene Expression 14 ... ecosystem 10 The biosphere is comprised of regions of the Earth’s crust, waters, and atmosphere inhabited by organisms 11 Each level of organization is more complex than the level preceding it 12 Each ... Learning Outcomes 1.1 The Characteristics of Life Distinguish between the levels of biological organization Identify the basic characteristics of life 1.2 Evolution and the Classification of Life Distinguish

Ngày tải lên: 31/01/2020, 14:47

13 38 0
Test bank and solution manual of essential of marketing research by malhotra (1)

Test bank and solution manual of essential of marketing research by malhotra (1)

... thinking Objective: 11 Copyright © 2015 Pearson Education, Inc 61) Which of the following is true about secondary data? A) Collection time is long B) Quality of data is high C) Cost of collecting ... Examples of this type of problem include the determination of the effectiveness of the current advertising campaign and the determination of the impact on sales and problems of various levels of price ... Specification of information needed is one of the components of the approach to the problem Answer: TRUE Diff: AACSB: Application of knowledge Objective: 38) By focusing on each component of the problem,

Ngày tải lên: 31/01/2020, 16:19

23 16 0
Analytical and numerical analyses on stiffness enhancement of ground improved by head enlarged CDM columns

Analytical and numerical analyses on stiffness enhancement of ground improved by head enlarged CDM columns

... 40 60 80 100 Samse project (Group 02) 12 Depth (m) Depth (m) 13 14 15 Samse project (Group 03) 10 11 13 CDM columns PF columns 14 15 (a) Group 02 10 11 Samse project (Optimal shape) 12 12 CDM columns ... columns 50 100 150 200 5 4 3 11 50 100 150 200 2 1 10 Depth (m) Settlement (mm) 13 CDM columns PF columns 14 15 (b) Group 03 (c) Optimal shape Figure 5.17 Settlement profiles with depth of footings ... geotechnics (1999): 281-296 74 [37] Schmertmann, J.H., Hartman, J.D and Brown, P (1978) Improved Strain Influence Factor Diagrams Journal of the Geotechnical Division, 104(No GT8), 1131–1135 [38] Schofield,

Ngày tải lên: 04/09/2020, 08:38

87 15 0
Analytical and numerical analyses on stiffness enhancement of ground improved by head enlarged CDM columns

Analytical and numerical analyses on stiffness enhancement of ground improved by head enlarged CDM columns

... geotechnics (1999): 281-296 74 [37] Schmertmann, J.H., Hartman, J.D and Brown, P (1978) Improved Strain Influence Factor Diagrams Journal of the Geotechnical Division, 104(No GT8), 1131–1135 [38] Schofield, ... Carter, J P (2011) Deformation Analysis in Soft Ground Improvement [10] Das, B M (2015) Principles of Foundation Engineering Cengage Learning [11] Das, B M., & Sobhan, K (2013) Principles of Geotechnical ... P (2019) Soft ground improvement by an improved CDM method 157-161 Vietnam – Japan Science and Technology Symposium (VJST2019) [29] Nguyen, D T (2019) An evaluation of the effectiveness of head-enlarged

Ngày tải lên: 27/10/2020, 19:57

98 15 0
Negative transcriptional control of ERBB2 gene by MBP-1 and HDAC1: Diagnostic implications in breast cancer

Negative transcriptional control of ERBB2 gene by MBP-1 and HDAC1: Diagnostic implications in breast cancer

... Contino et al BMC Cancer 2013, 13:81 http://www.biomedcentral.com/1471-2407/13/81 RESEARCH ARTICLE Open Access Negative transcriptional control of ERBB2 gene by MBP-1 and HDAC1: diagnostic implications ... gene, may contribute to MBP-1 expression in a variety of normal tissues and cancer cells [10] Exogenous MBP-1 expression inhibits the growth of breast tumors in nude mice [11], induces cell death ... unaffected by MPB-1 expression These results indicate that the region between nucleotide −514 and −262 of the ERBB2 proximal promoter Contino et al BMC Cancer 2013, 13:81 http://www.biomedcentral.com/1471-2407/13/81

Ngày tải lên: 05/11/2020, 07:12

12 8 0
(Luận văn thạc sĩ) analytical and numerical analyses on stiffness enhancement of ground improved by head enlarged CDM columns

(Luận văn thạc sĩ) analytical and numerical analyses on stiffness enhancement of ground improved by head enlarged CDM columns

... 40 60 80 100 Samse project (Group 02) 12 Depth (m) Depth (m) 13 14 15 Samse project (Group 03) 10 11 13 CDM columns PF columns 14 15 (a) Group 02 10 11 Samse project (Optimal shape) 12 12 CDM columns ... columns 50 100 150 200 5 4 3 11 50 100 150 200 2 1 10 Depth (m) Settlement (mm) 13 CDM columns PF columns 14 15 (b) Group 03 (c) Optimal shape Figure 5.17 Settlement profiles with depth of footings ... geotechnics (1999): 281-296 74 [37] Schmertmann, J.H., Hartman, J.D and Brown, P (1978) Improved Strain Influence Factor Diagrams Journal of the Geotechnical Division, 104(No GT8), 1131–1135 [38] Schofield,

Ngày tải lên: 06/12/2020, 19:02

87 14 0
báo cáo khoa học: " Cloning of transgenic tobacco BY-2 cells; an efficient method to analyse and reduce high natural heterogeneity of transgene expression" docx

báo cáo khoa học: " Cloning of transgenic tobacco BY-2 cells; an efficient method to analyse and reduce high natural heterogeneity of transgene expression" docx

... (Fermentas), sequencing was done by Sequencing laboratory, Faculty of Science, Charles University in Prague, Czech Republic) http://www.biomedcentral.com /14 71- 2229/9/44 10 11 12 13 14 Authors' contributions ... and DNA methylation Plant J 2008, 53 :1- 10 Müller E, Lorz H, Lutticke S: Variability of transgene expression in clonal cell lines of wheat Plant Sci 19 96, 11 4: 71- 82 Down RE, Ford L, Bedford SJ, Gatehouse ... several causes Lines 1/ and 1/ 3 were composed of two genetically different clones that were separable by cloning, as shown by comparing 1/ 7d with 1/ 7o or 1/ 3f with other 1/ 3 clones (Figure 5)...

Ngày tải lên: 12/08/2014, 03:20

11 302 0
Performance enhancement of solar module by cooling: An experimental investigation

Performance enhancement of solar module by cooling: An experimental investigation

... Volume 3, Issue 1, 2 012 , pp.73-82 [5] [6] [7] [8] [9] [10 ] [11 ] [12 ] [13 ] [14 ] 81 William G Anderson1, Sanjida Tamanna, David B Sarraf and Peter M Dussinger, Heat Pipe Cooling of Concentrating ... thickness The function of slope and intercept in terms of thickness t is thus derived from the graph f1(t)=[0. 011 xt3]-[0 .12 8xt2]+[0.397xt] (4) f2(t)=[-0.029xt3]+[0.372xt2]- [1. 267xt]-0.005 (5) Thus ... Tolerance No of cells Dimensions (mm) Temperature co-efficient Fill factor (FF) Viscosity of silicone oil (mPas) USP7 Watts 10 V 8.5V 1A 0.82A 10 % 18 320x420x50 NOCT 45oC 0.7 387 Figure Schematic of experimental...

Ngày tải lên: 05/09/2013, 16:11

10 338 0
Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf

Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf

... was extremely low (4.24 · 10 3 copies of AtZFP 11 lg )1 of total RNA) In 35S:AtZFP 11 Arabidopsis plants, the average AtZFP 11 mRNA level observed was 2.98 · 10 5 copiesÆlg )1 of total RNA, which is 70.3-fold ... 2000 15 00 10 00 500 VGCfEWt:Luc 0.64 3.2 16 80 400 2000 10 000 35S:Luc Methoxyenozide (nM) 0.64 3.2 16 80 400 2000 10 000 0.64 3.2 16 80 400 2000 10 000 0.64 3.2 16 80 400 2000 10 000 0.64 3.2 16 80 ... 2000 10 000 0 0.64 3.2 16 80 400 2000 10 000 Luciferase (RLU·µg 1 protein) B 0.64 3.2 16 80 400 2000 10 000 0 0.64 3.2 16 80 400 2000 10 000 500 0.64 3.2 16 80 400 2000 10 000 Luciferase (RLU·µg 1 protein)...

Ngày tải lên: 16/03/2014, 06:20

16 454 0
Báo cáo khoa học: Control of transferrin expression by b-amyloid through the CP2 transcription factor pdf

Báo cáo khoa học: Control of transferrin expression by b-amyloid through the CP2 transcription factor pdf

... II III IV II 13 1 Mutant –600 ~ 13 1 –600 Mutant –600 ~ 18 8 –600 B –82 18 8 TF-luc : WT mut mut mut n.s 14 Fold change +1 1 n.s n.s 10 11 12 13 14 15 16 – – – – + – – – – + ** 12 10 2 FLAG-CP2 ... -ACCTAAGGTAGGTGCCTAGACAGGGTCTCGGGTCTTTTACTCCACTAGTCGGACCCGCTCCTTACTTCACCCT-CCCTACTTTCCGCTAA AcaC 19 3 acctAAGGT G G C AGaca GGT Tc aGTC TTTACTCCACTaGT g 17 8 15 9 CcG TC TT CTTCcCCC 13 0 CC aC cCC CTAA 11 5 11 3 10 5 +1 CP2 I Homo sapiens :CCCGTTGGGCCGACGTGTTTGTGCCCTCCAGTTTCTAACGCGGGTCGGGCGGGTCCGGCCCTTACCTTATTTCCCTGCGCCCCGCGGCCTCCGA ... analysis revealed that there are four CP2 consensus sites at positions )17 8 to )15 9, )13 0 to )11 3, )11 5 to )10 5 and )53 to )35 (Fig 1B) Transcription factor CP2 increases the endogenous transferrin...

Ngày tải lên: 23/03/2014, 03:20

12 371 0
Báo cáo lâm nghiệp:"Stability of transgene expression in poplar: A model forest tree species" ppsx

Báo cáo lâm nghiệp:"Stability of transgene expression in poplar: A model forest tree species" ppsx

... analyses of locus numbers of transgene in the group transgenic lines indicated that the lines A, B, C and D contained 1, 2, and loci of the uidA gene, Stability of transgene expression in poplar 4 31 ... in 19 92 and 19 93 by GUS fluorometry of transgene activity in group plants indicated that while 436 S Hawkins et al Figure RT-PCR of silenced line pBI -12 1-4 (35S-uidA) PCR with uidA primers (G1G5); ... gene silencing, Curr Opin Plant Biol (19 99) 10 911 3 [3] Bevan M., Binary Agrobacterium vectors for plant transformation, Nucleic Acids Res 12 (19 84) 8 711 87 21 [4] Bishop-Hurley S.L., Zabkiewicz...

Ngày tải lên: 08/08/2014, 01:21

12 361 0
w