... diagnostic tests and cancer treatments. The procedures used to diagnose prostate cancer may cause significant side effects, including bleeding and infection. Prostate cancer treatment often causes ... that screening for prostate cancer may have reduced prostate cancer mortality rates, but this remains controversial. [2] Current American Cancer Society guidelines for prostate cancer screening ... The presence of PSA does not necessarily mean that the body is reacting against cancer cells Other conditions can affect PSA: * Prostatitis and Lower Urinary Tract symptoms (LUTS) can elevate...
Ngày tải lên: 21/03/2014, 12:19
Báo cáo y học: "All duplicates are not equal: the difference between small-scale and genome duplicatio" docx
Ngày tải lên: 14/08/2014, 08:20
229. The Difference Between Giving Credit and Taking Credit ppsx
Ngày tải lên: 14/08/2014, 21:21
The 10 Most Significant Differences between C# and C++
... 135 wrapper class, 342 WriteLine() command, as function call, 74, 160 writing code, CD115–CD119 collection class, CD61–CD71 constant, CD6 forms code, CD175–CD179 generic code, 348–349 generic collections, ... 110 StreamReader, CD50–CD54 StreamWriter, CD45–CD50 String, 187 structure compared to, 327 wrapper, 342 class constructor, 235–236 class function, 128 class inheritance, 219 class library, CD27, CD29, CD39–CD43 393 Index 28_597043 ... 254–257 BankAccount program, 222–224 BankAccount ConstructorsAnd Function program, 245–247 BankAccount ConstructorsAndThis program, 247–248 BankAccountWith Multiple Constructors program, 243–245 base class...
Ngày tải lên: 04/10/2013, 21:20
Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt
... CA, USA), and the two synthesized oligonucleotides P his (5Â-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3Â) and P MluI (5Â-GTACACGCG TCTGATCAG-3Â) were inserted into the 3Â-end of ... National Science Council, Republic of China: NSC 96-2627- M-007-003 and NSC 97-2627-M-007-003 to R. L. Pan, NSC 96-2627-M-009-001 to S. K. Fan, NSC 96-2627- M-007-004 to C. C. Fu, and NSC 96-2627-M-007-003 to ... Santa Bar- bara, CA, USA) and a Picoplus instrument (Molecular Imaging, MI, USA). Muscovite mica (Electron Microscopy Sciences, Hatfield, PA, USA) was freshly cleaved and immediately covered with...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf
... AAACATATGCTATATTACAATAAAA GG; 2.2up, AAACATATGTTATCTATCGTTGTAAAGC; 2.3up, AA ACATATGCTTGTTCCTCAAAAACTTCC; 3.3rv, AAACTCGAGGACCTTAGCCGTAGTCTTCAC; 3.2rv, AAACTCGAGTTTTCCATTCAAAACCGTG. Construction of site directed mutants The ... CD D3 CD D3 CD + D3 + CD D3 CD + D2 CD + D2 CD + CD-D123 CD-St2.1 CD-St2.2 CD-St2.3 CD+D123 CD+D23 CD+D3 CD+D2 CD+D1 CD + St2.1 CD + St2.2 CD + St2.3 CD + St3.3 CD + St3.2 D1 D2 D3 CD CD-D123W366A x W366A D1 ... Luis Burgos [Comision de Investigaciones Cientificas (CIC)] for excellent techni- cal assistance and Dr Marı ´ a Corvi for helpful discus- sions and critical reading of the manuscript. This work was...
Ngày tải lên: 22/03/2014, 21:20
WORKING PAPER SERIES NO. 548 / NOVEMBER 2005: THE LINK BETWEEN INTEREST RATES AND EXCHANGE RATES DO CONTRACTIONARY DEPRECIATIONS MAKE A DIFFERENCE? doc
... in domestic currencies could lead to c ontractions in economic activity (that is, the existence of "contractionary devaluations"). According to Eichengreen (2005), Mohanty and Klau (2004) and ... possibility of contractionary depreciations, produces testable implications about the relationship between interest rates and ex- change rates that stand the chance of matching the empirical evidence for EMEs. ... exchange rate ‡oat only since 1999), Mexico and Colombia in 1999, Brazil in 2000, and Peru in 2002. Among Eastern and Central European countries, EU new member states Czech Republic and Poland...
Ngày tải lên: 22/03/2014, 23:20
Báo cáo khoa học: Investigation of the interaction between the atypical agonist c[YpwFG] and MOR docx
... receptors (MORs). In certain cases, the Keywords atypical agonist; cyclopentapeptide; induced fit; molecular docking; opioid receptor Correspondence L. Gentilucci, Dipartimento di Chimica ‘G. Ciamician’, ... in-solution conformational features of compound 3, compound 7, c[ YpwFp], which shows lddld chirality, and compound 8, c[ YpwFP], having lddll chirality, by spectroscopic and molecular dynamics (MD) ... the difference between the 13 C- NMR chemical shifts (data not shown) of Pro-Cb and Pro-Cc (e.g. at 26.7 and 24.3, respectively, for d-Pro2 in compound 3) confirmed the configuration of the preceding peptide...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: "Combining Word-Level and Character-Level Models for Machine Translation Between Closely-Related Languages" ppt
... shows how character- level phrase tables can cover mappings spanning over multi-word units. Thus, character- level phrase-based SMT mod- els combine the generality of character- by -character transliteration ... into account: (1) word- internal letter context, and (2) sentence-level word context. We generated a lattice for each Macedonian test sentence, which included the original Mace- donian words and ... automatically extracted pairs of likely cognates. 3.1 Cognate Extraction Classic NLP approaches to cognate extraction look for words with similar spelling that co-occur in par- allel sentences (Kondrak...
Ngày tải lên: 23/03/2014, 14:20
Báo cáo hóa học: " Research Article Relations between Limit-Point and Dirichlet Properties of Second-Order Difference Operators A. Delil" pdf
... which A and B are constants, and Φ n = n m=0 ψ m ϕ n − ϕ m ψ n w m f m , n ∈ N, Φ −1 = 0. (3.33) Since {ϕ} ∞ − 1 and {ψ} ∞ − 1 are bounded by case (i) of condition (c) , using also Cauchy- Schwarz ... March 2007; Accepted 11 April 2007 Dedicated to Professor W. D. Evans on the occasion of his 65th birthday Recommended by Martin J. Bohner We consider second-order difference expressions, with complex ... Equations Volume 2007, Article ID 94325, 15 pages doi:10.1155/2007/94325 Research Article Relations between Limit-Point and Dirichlet Properties of Second-Order Difference Operators A. Delil Received 24 July...
Ngày tải lên: 22/06/2014, 19:20
SOLVABILITY CONDITIONS FOR SOME DIFFERENCE OPERATORS N. C. APREUTESEI AND V. A. VOLPERT Received 24 docx
... (5.9) Case 1 (c& gt;−1). From b<0, c& gt;−1, we derive q>0andp + q +1< 0. Consequently p<−1. A simple computation leads to the conclusion that σ 1 > 1and 2 ∈ (−1,1). Case 2 (−2 ≤ c& lt;−1). ... operators with finite-dimensional kernels. Since at +∞ and −∞ the operators L + and L − coincide, we finally reduce L to an operator with constant coefficients. According to Theorem 2.4, it is invertible. ... result can be deduced for L − . Proposition 5.3. If b + ,b − < 0 and c + ,c − ≥−2, then L is a Fredholm operator and its index is zero. SOLVABILITY CONDITIONS FOR SOME DIFFERENCE OPERATORS N. C. ...
Ngày tải lên: 23/06/2014, 00:20
Báo cáo y học: "Where is the difference between the genomes of humans and annelids" pot
Ngày tải lên: 14/08/2014, 16:20
Pointers and Dynamic Arrays
... declared in a function are created by C+ + and destroyed when the function ends These are called automatic variables because their creation and destruction is controlled automatically The programmer ... (2) Dynamic Arrays (cont.) Slide 9- 34 Copyright â 2007 Pearson Education, Inc. Publishing as Pearson Addison-Wesley Pointer Arithmetic (Optional) Arithmetic can be performed on the addresses contained ... 9- 15 Copyright â 2007 Pearson Education, Inc. Publishing as Pearson Addison-Wesley Variables created using the new operator are called dynamic variables Dynamic variables are created and destroyed...
Ngày tải lên: 12/09/2012, 22:51
The relationship between default risk and interest rates: An empirical study research insight
... Mansi, and W. Maxwell. “The Dynamics of Corporate Credit Spreads,” Journal of Economic Finance, May 2001. 12. Lin, M. and J -C Curtillet. “Another Look at the Relation between Credit Spreads and ... (1998), Collin-Dufresne et al. (2001), and Lin and Curtillet (2007). We also find positive correlations between slopes and default rates, and significant positive correlations between changes ... between interest rates and aggregate default rates, including contemporaneous correlations, and correlations over time. 4.1 Contemporaneous Correlations Changes in interest rates can impact...
Ngày tải lên: 26/10/2012, 11:21
Báo cáo y học: " Relationship between anal symptoms and anal findings"
... often exclude more serious causes of anal bleeding such as colorectal cancer [6,7] since pa- tients with anal complaints but without colorectal cancer are neglected. Anal bleeding, anal itch, anal ... by physicians and surgeons and overemphasized by dermatologists. Proctologic patients often receive conflicting opinions from clinicians [3,13,14,24,26,27] since with different specialists, ... almost carpet like to the anal verge (definition table 4). Statistics Means +/- standard deviation were computed for continuous variables such as age. Frequencies and percentages were calculated...
Ngày tải lên: 03/11/2012, 11:24