creating altering and dropping tables with t sql

Designing and Implementing Databases with Microsoft SQL Server 2000 Enterprise Edition

Designing and Implementing Databases with Microsoft SQL Server 2000 Enterprise Edition

... not UPDATE STATISTICS by itself but can turn on the automatic UPDATE STATISTICS procedure This update is performed by the task that detected that the statistics needed to be updated The update ... constraint between the two tables, and rows must be deleted from both tables A simple DELETE statement cannot accomplish this Two DELETE statements must be used; first one DELETE statement on the Parts ... packages that export the data from the database and place the data into tab-delimited text files Create an application that uses SQL_ DMO to extract the data from the database and transform the data...

Ngày tải lên: 04/11/2013, 16:15

196 645 1
beginning  t-sql  with  microsoft  sql  server  2005  and  2008

beginning t-sql with microsoft sql server 2005 and 2008

... stored With a varchar data type on a table column, the data is stored physically in the row with the rest of the data With a text data type, the data is stored separately from the actual row and ... how the INSERT, UPDATE, and DELETE statements interact with the relational database engine and transaction log to lock and modify data rows with guaranteed consistency You will not only learn to ... language and data management systems, and then continue with the SQL Server product fundamentals This first section teaches the essentials of the SQL Server product architecture and relational database...

Ngày tải lên: 05/05/2014, 13:09

675 772 0
mapping your objects to database tables with linq to sql

mapping your objects to database tables with linq to sql

... Tables with LINQ to SQL Tasks Detailed Steps } … } Note: Notice that you not set the value of the _Orders object, but rather call its Assign method to create the proper assignment The EntitySet type ... Mapping Your Objects to Database Tables with LINQ to SQL Table of Contents Mapping Your Objects to Database Tables with LINQ to SQL Exercise Creating Your First LINQ TO SQL Application ... Database Tables with LINQ to SQL Tasks Detailed Steps physically contain all the rows from the underlying table but acts as a typed proxy for the table Note: The next step retrieves data from the database...

Ngày tải lên: 06/08/2013, 17:30

29 435 0
Tài liệu Use Variables and Functions in T-SQL pptx

Tài liệu Use Variables and Functions in T-SQL pptx

... the "Technique" section, this code then assigns the routine to the Text property of the Label called lblSQLString It then creates a data adapter using the string and fills the dtResults DataTable ... the controls listed in Table 6.2 and seen in Figure 6.3 with the following properties set Table 6.2 Control Property Settings for This How-To Object Property Setting Label Text SQL Statement Label ... How-To calls the DateDiff() function As with Visual Basic's DateDiff() function, this function takes two dates, and based on the interval requested, it returns the difference between the two To...

Ngày tải lên: 14/12/2013, 20:16

4 548 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

... TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third ... encoding the mature protein (5¢ primer, 5¢-CATGCCATGGCCAGTAGTCAGCCTGACCCTACT CCAG-3¢; 3¢ primer, 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen ... properties with the staphylococcal enterotoxins SEB and SEC than with other streptococcal SAgs [19] Cellular proliferation studies show disagreement about which TCR bearing T- cell subsets are expanded...

Ngày tải lên: 07/03/2014, 16:20

9 485 0
Creating and Managing Tables potx

Creating and Managing Tables potx

... TIMESTAMP[(fractional_seconds_precision)] WITH TIME ZONE 9-15 Copyright © Oracle Corporation, 2001 All rights reserved TIMESTAMP WITH LOCAL TIME Data Type • TIMESTAMP WITH LOCAL TIME ZONE is another variant of TIMESTAMP that includes ... extension of the DATE data type • It stores the year, month, and day of the DATE data type, plus hour, minute, and second values as well as the fractional second value • The TIMESTAMP data type is ... Enhancements have been made to time zones and local time zone Data Type Description TIMESTAMP Date with fractional seconds INTERVAL YEAR TO MONTH Stored as an interval of years and months INTERVAL...

Ngày tải lên: 29/03/2014, 16:20

33 404 0
electronic devices and amplifier circuits with matlab applications - steven t. karris

electronic devices and amplifier circuits with matlab applications - steven t. karris

... external circuit consists of electrons moving out of the negative terminal of the battery and into the positive terminal of the battery Hole flow, on the other hand, only exists within the material ... crystal that has been thermally agitated we have two types of current movement; the free electron movement and the hole movement The movement of holes can be best illustrated with the arrangement ... applications, the Zener, Schottky, tunnel, and varactor diodes, and optoelectronics devices Chapters and are devoted to bipolar junction transistors and FETs respectively, and many examples with detailed...

Ngày tải lên: 08/04/2014, 10:08

629 1,3K 0
signals and systems with matlab computing and simulink modeling - steven t. karris

signals and systems with matlab computing and simulink modeling - steven t. karris

... ∞ < t < +∞ To this, it is convenient to divide the time interval into two parts, – ∞ < t < , and < t < ∞ For the time interval – ∞ < t < , the switch is open and therefore, the output voltage ... property states that e ∞ t ∫– ∞ t e t δ ( t – ) dt = t e t= 2 = 4e –2 ∞ ∫–∞ f ( t )δ ( t – α ) dt = f ( α ) Thus, = 0.54 f We recall that the sampling property for the doublet states that f ( t ... )δ ( t ) = f ( )δ ( t ) • The sifting property of the delta function states that ∞ ∫–∞ f ( t )δ ( t – α ) dt = f(α) • The sampling property of the doublet function δ' ( t ) states that f ( t )δ'...

Ngày tải lên: 08/04/2014, 10:28

651 473 0
báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot

báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot

... pulsed with class I epitope of hTERT, with or without class II epitopes This strategy has been used previously with melanoma-related antigen class I peptides to compare the activity of immature and ... taking systemic steroids, nor did they have any medical contraindication to enrolment Patients Ten patients (6 with prostate cancer, with malignant melanoma, with breast cancer and with lung cancer) ... Results are represented as mean (SD) Statistically significant SCC-4 cytotoxicity was observed with DCT and DCTI re-stimulated PBMCs compared with PBMCs restimulated without the class I peptides...

Ngày tải lên: 18/06/2014, 15:20

23 439 0
Learning Joomla 1.5 Extension Development Creating Modules, Components, and Plug-Ins with PHP pptx

Learning Joomla 1.5 Extension Development Creating Modules, Components, and Plug-Ins with PHP pptx

... shows the Joomla! root with the administrator folder expanded: Notice that the administrator folder has a structure similar to the root folder It is important to differentiate between the two, ... component is not built to take this into account, it is possible that website administrators will lose their template and module selections To take advantage of the system, it is necessary to use the ... administrative functions into the front-end code This is an important distinction as the front end and back end are similar in structure [ 13 ] Getting Started with Component Development The following...

Ngày tải lên: 27/06/2014, 14:20

171 489 0
Báo cáo y học: "Reduced proportions of natural killer T cells are present in the relatives of lupus patients and are associated with autoimmunity" ppt

Báo cáo y học: "Reduced proportions of natural killer T cells are present in the relatives of lupus patients and are associated with autoimmunity" ppt

... important clues to the genesis of these conditions Competing interests The authors declare that they have no competing interests Authors' contributions JW participated in study design; coordinated ... compartment They also had increased CD4+ T- cell activation, with an increased proportion of recently activated CD69+CD4+ T cells Consistent with reports in the literature, lupus patients had ... recent study [38] found no significant difference between the proportion of cells detected by anti-Vα24 and anti-Vβ11 staining, and those observed after staining with CD1d tetramers loaded with the...

Ngày tải lên: 09/08/2014, 13:21

13 451 0
báo cáo khoa học: "Analysis of the expression pattern of the BCL11B gene and its relatives in patients with T-cell acute lymphoblastic leukemia" doc

báo cáo khoa học: "Analysis of the expression pattern of the BCL11B gene and its relatives in patients with T-cell acute lymphoblastic leukemia" doc

... 5’-6FAM-TCACCCACGAAAGGCATCTGTCCCAAGCA-TAMRA probe b2Mf 5’-CTCGCGCTACTCTCTCTTTCT forward primer b2Mb 5’-TACATGTCTCGATCCCACTTAACTAT backward primer b2Mp 5’-6FAM-CTCACGTCATCCAGCAGAGAATGGAAAGTCA-TAMRA ... transcriptase Superscript II Kit (Invitrogen), according to the manufacturer’s instructions Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) Quantitative detection of the ... primer SPP1 5’-TCAGGTCTGCGAAACTTCTTAG-3’ backward primer CREBBP 5’-CGGTTTCTCGGCGAATGAC-3’ forward primer CREBBP 5’-CATTTCCTATTCCTGGGTTGAT-3’ backward primer Figure Expression levels of the BCL11B...

Ngày tải lên: 10/08/2014, 22:21

7 411 0
Lập trình T SQL - slide

Lập trình T SQL - slide

... Day T vi t t t hh Mi Ss Ms Dy Dd Giá trị 0-23 0-59 0-59 0-999 1-366 1-31 Database Design and Implementation with SQL Server / Session /30 of 36 Date Parts (tiếp…) Datepart T vi t t t Giá trị ... khóa GOTO bỏ qua tiến trình thực thi tiếp t c vị trí nhãn mệnh đề GOTO Cú pháp: GOTO nhãn Database Design and Implementation with SQL Server / Session /17 of 36 RETURN RETURN: Ta dùng RETURN lúc ... sau TSQL: Database Design and Implementation with SQL Server / Session /23 of 36 Các biến toàn cục Biến toàn cục SQL Server b t đầu ký t @ Ta truy xu t giá trị biến truy vấn SELECT đơn giản Database...

Ngày tải lên: 07/09/2012, 09:27

36 1,1K 8
T-SQL Programming

T-SQL Programming

... lệnh T- SQL để thay ký t c t Titleid t bảng Titles ‘ABB’ với điều kiện kiểu(type) ‘business’ Vi t câu T- SQL để hiển thị t n nhà xu t khác chữ thường 78 Database Design and Implementation with SQL ... Quantity > 100 Trả số lượng m t hàng yêu cầu có quantity > 100 SELECT MAX(Quantity * UnitPrice)As 'Largest Order' Database Design and Implementation with SQL Server T n Hàm Min (t n c t) Giá trị trả ... Avg (t n c t) Trả giá trị trung bình t p hợp giá trị c t Trả giá trị t ng trường ‘Quantity’ t bảng WidgetOrders SELECT AVG(UnitPrice * Quantity) As AveragePrice FROM WidgetOrders WHERE Continent...

Ngày tải lên: 11/09/2012, 13:54

19 2,8K 7
Lập trình T - SQL và các quản lý bảo mật

Lập trình T - SQL và các quản lý bảo mật

... lệnh SQL Ví dụ, gán giá trị cho biến khai báo trước SET @Contact = 'Sales Manager' SELECT * FROM Customers WHERE contacttitle = @contact K t khối lệnh SQL hiển thị hình 8.5 Lập trình T- SQL , ... nghĩa giao t c t ờng minh Sử dụng BEGIN COMMIT TRANSACTION Câu lệnh BEGIN TRANSACTION đánh dấu điểm b t đầu giao t c COMMIT TRANSACTION đánh dấu k t thúc giao t c Chúng ta t ng giá trị UnitPrice ... GO CREATE TABLE [dbo].[Batch] ( [BatchNo] int NULL , [DateStarted] Datetime NULL , [NoOfStudentsEnrolled] [int] NULL , [MinimumNumberOfStudents] [int] NULL, [MaximumNumberOfStudents] [int] NULL,...

Ngày tải lên: 11/09/2012, 13:54

12 832 7
Báo cáo y học: "Effects of p-Synephrine alone and in Combination with Selected Bioflavonoids on Resting Metabolism, Blood Pressure, Heart Rate and Self-Reported Mood Changes"

Báo cáo y học: "Effects of p-Synephrine alone and in Combination with Selected Bioflavonoids on Resting Metabolism, Blood Pressure, Heart Rate and Self-Reported Mood Changes"

... that measures oxygen consumption (VO2) to determine resting metabolic rate (RMR) In conjunction with the study, test-retest reliabilities of the instrument were measured on 41 subjects from test-retest ... heart-rate and RMR were determined Statistical Analyses ANOVAs were calculated between the groups’ baseline, ending and change scores for each treatment group in addition to Dunnett’s t- test between ... heart-rate and self-reports in the four treatment groups, the consistency of the effects of p-synephrine on metabolism in all treatment groups, and the increases in RMR in the treatment groups The...

Ngày tải lên: 25/10/2012, 11:04

7 641 0
Báo cáo y học: "Weight loss, leukopenia and thrombocytopenia associated with sustained virologic response to Hepatitis C treatmen"

Báo cáo y học: "Weight loss, leukopenia and thrombocytopenia associated with sustained virologic response to Hepatitis C treatmen"

... attributed to our supportive staff and follow-up system The potential interaction between psychiatric illness and its treatment with HCV therapy could not be assessed with our limited study This ... weight but did not achieve their baseline bodyweight In our study, patients with SVR had significantly lower WBC and platelet count at the end of treatment compared to those without SVR These ... factor for HCV treatment failure, and weight reduction was associated with treatment success (10, 20) However, other studies demonstrated that weight loss did not improve the treatment outcomes...

Ngày tải lên: 26/10/2012, 09:39

7 519 0
w