coupled transport by a membrane protein

Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt

Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt

... uuaccugccaucaau; ZIP8 #2, ccgauuucaccuucuucaugauuca; ZIP8 #3, ggauuccugucagugacgauuauua; eGFPsi, gcaagcuga cccugaaguucau; PKCa #1, ccaucggauuguucuuucuucauaa; PKCa #2, gccuccauuugauggugaagaugaa; ... PKCd #1, ccacu acaucaagaaccaugaguuu; and PKCd #2, ccauccacaagaaaugc aucgacaa PKCe #1, PKCe #2 and PKC siRNAs are the ‘validated Stealth RNAi duo pak’ from Invitrogen (Cergy Pontoise, France) Only ... ERK activation is inhibited by PKC a 50% decrease in cadmium accumulation, a simultaneous PMA treatment was still able to reduce cadmium accumulation by an additional 30% The simplest explanation...

Ngày tải lên: 23/03/2014, 06:20

13 331 0
Báo cáo sinh học: " Panicovirus accumulation is governed by two membrane-associated proteins with a newly identified conserved motif that contributes to pathogenicity" pptx

Báo cáo sinh học: " Panicovirus accumulation is governed by two membrane-associated proteins with a newly identified conserved motif that contributes to pathogenicity" pptx

... CTCCAGACAGCCGCCTGGTTAGC CACACCCTGTAGAGGGCTCTCCAG CCTTTCTTATCAGCCACCCTGTAGAG GGAATACAGCTGGCAAGGC TGATCCTGGGCGTATGCGC GCCCCAACTAATGCATTGGTCACTAG CCAAGCAGTCGCATTGGCCCC a The altered nucleotides on the PMV cDNA are ... P31 7A- 989R N32 3A- 1007R L32 5A- 1014R REP/Y -A 1044R-C /A REP/F -A REP/D -A MUTPMV-1236R REP/W -A CCCCAGCGGCTTCGTTCTTTGC GGAACCCCAGCAAACTCGTTCTTTGC CTGTGGGTTTTGCAACCCCAGCG CAGCCAACTGGGCAGCCTCTGTG CTCCAGACAGCCGCCTGGTTAGC ... peroxidase (Amersham Pharmacia Biotech, Piscataway, NJ) was used at a 1:5,000 dilution and assayed by enzymatic reactions The remaining half of the extract was prepared for RNA blots, as described...

Ngày tải lên: 19/06/2014, 08:20

12 307 0
Treatment of Textile Wastewater by a Coupling of Activated Sludge Process with Membrane Separation

Treatment of Textile Wastewater by a Coupling of Activated Sludge Process with Membrane Separation

... COMPRESSED AIR INFLUENT AIR SLUDGE WASTE Fig Schematic Diagram of the Coupling of Activated Sludge Process and Membrane Separation MATERIALS AND METHODS Wastewater preparation The wastewater was obtained ... microorganism ratio (F/M ratio), sludge wastage rate, and sludge settling characteristic in sedimentation tank An increase in biomass concentration will increase degradation rate and reduce the area ... from chemical treatment is classified as a hazardous waste, so it should be treated in a proper way This means that the sludge disposal causes a substantial increase in wastewater treatment cost...

Ngày tải lên: 05/09/2013, 09:08

8 434 0
Spatial moment analysis of colloid facilitated radionuclide transport in a coupled fracture-matrix system

Spatial moment analysis of colloid facilitated radionuclide transport in a coupled fracture-matrix system

... facilitated transport of radionuclides in discretely fractured porous media The model accounts for aqueous phase contaminant transport in fracture and matrix, colloid transport in fracture, and ... and Stafford,P.L Lanthanide surface roughness on the colloidal forces between a particle and field tracers demonstrate enhanced transport of transuranic radionuclides by natural organic matter ... them Transport along the fracture is much faster than transport in the rock-matrix The fracture as well as the rock-matrix is saturated Figure Schematic representation of a fracture-matrix coupled...

Ngày tải lên: 05/09/2013, 17:03

14 478 0
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

... anti-GST and anti-Flag (Sigma), and anti-PARP (Cell Signal) The ProteoExtract Subcellular Proteome Extraction Kit (Calbiochem, La Jolla, CA, USA) was used to extract proteins from mammalian cells according ... mRNA level is depicted as a ratio of DAPK-1 ⁄ s-DAPK-1 to actin (E, F) s-DAPK-1, DAPK-1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA quantification in colon carcinoma and rectal carcinoma ... TGGA-3¢ The s-DAPK-1 primers were as follows: forward, 5¢-CGTCTCTCCAGCAGGTGTT-3¢; reverse, 5¢-TA AGGCCACAGGGTCCAGTA-3¢ Immunostaining and membrane- blebbing assay A3 75 cells were analyzed by immunostaining...

Ngày tải lên: 18/02/2014, 17:20

11 659 0
Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc

Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc

... conjugated upper primer was 5¢-GGAATTCCGCCACCATGCCATA CGATGTTCCAGATTACGCT-3¢ The XbaI restriction site-conjugated lower primer was 5¢-GCTCTAGAGCTCA TTTCCGACTGAAGA-3¢ Amplification of bcl-XL cDNA was ... Tsukahara T, Kannagi M, Ohashi T, Kato H, Arai M, Nunez G, Iwanaga Y, Yamamoto N, Ohtani K, Nakamura M et al (1999) Induction of Bcl-x(L) expression by human T-cell leukemia virus type Tax through ... addition and analyzed for caspase activity by using a fluorometric substrate-based assay Each point is the mean of triplicate samples, and the bar represents the standard deviation Similar results...

Ngày tải lên: 19/02/2014, 06:20

13 494 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

... Hagiwara, Y., Hagiwara, H., Ueyama, H & Goldstein, A. L (1994) Isolation of a vitamin E analog from a green barley leaf extract that stimulates release of prolactin and growth hormone from rat anterior ... highest grade commercially available Data were expressed as the mean ± standard deviation of at least three independent experiments Statistical significance was assessed by multiple-comparison test ... the antioxidants BHA and AsA These results suggested that active oxygens and free radicals did not participate in the TS effect, and that the inhibitory effect of a- T was mediated by a nonantioxidative...

Ngày tải lên: 22/02/2014, 04:20

6 494 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... potential coadjuvants of those antimicrobial agents that are already available after incubation for 18–20 h at 37 °C Antibacterial activity was expressed as MIC, the concentration of peptide at which ... Sigma All other chemicals were reagent grade For antimicrobial assays, the commercially available quality control strain E coli ATCC 25922 was used The bactericidal activity of Esc(1–18) against...

Ngày tải lên: 16/03/2014, 00:20

18 494 0
Báo cáo khoa học: High levels of structural disorder in scaffold proteins as exemplified by a novel neuronal protein, CASK-interactive protein1 pot

Báo cáo khoa học: High levels of structural disorder in scaffold proteins as exemplified by a novel neuronal protein, CASK-interactive protein1 pot

... C-terminal Caskin1 are functional and may interact with SH3 domain-containing proteins, such as Abi2 [We have also found an in vivo association and colocalization of Abi2 with Caskin1 (A Balazs, ... of Caskin1 The N-terminal half contains six ankyrin repeats, one SH3 domain and the two SAM domains, whereas the C-terminal half contains no recognizable domain, and has been designated as a proline-rich ... often lack any sequence similarity to other proteins and appear to lack folded structural domains, we anticipated that structural disorder may be a general feature of scaffold proteins In a recent...

Ngày tải lên: 16/03/2014, 02:20

13 408 0
Báo cáo Y học: Identification of novel membrane proteins by searching for patterns in hydropathy profiles potx

Báo cáo Y học: Identification of novel membrane proteins by searching for patterns in hydropathy profiles potx

... arranged as a pair of peaks, followed by a deep valley (< )1.9), then a cluster We have developed and tested an algorithm that can scan a large polypeptide database, and retrieve membrane proteins ... with functional analysis, and may also be useful in proteome database annotation METHODS An algorithm was developed for searching a large polypeptide sequence database for proteins that are likely ... the base threshold was set relatively high Therefore, narrow peaks were not rejected A putative transmembrane domain occasionally appeared as two narrow peaks Therefore, a pair of peaks separated...

Ngày tải lên: 17/03/2014, 23:20

7 407 0
Báo cáo Y học: Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants docx

Báo cáo Y học: Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants docx

... The absorbance was read by TitertekÒ Multiskan (ICN Flow, USA) The amount of IgA present in each supernatant was calculated relative to a standard preparation with known concentration Verification ... Kodak X-OMAT film for 15–60 s Dot blot density was analysed by TOTALLAB gel software (Phonetix, UK) The amount of SC present in each supernatant was calculated relative to a standard preparation ... demonstrated that a sufficient amount of J-chain was available for SIgA complex formation One SIgA-producing clone (SIgA-3) along with pIgA-D and IgA-29 were analysed by SDS/PAGE gel and Western...

Ngày tải lên: 18/03/2014, 01:20

6 371 0
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

... Q8WZT0) and Pseudomonas aeruginosa (TrEMBL db: Q9I710) It has been speculated that Aa-Pri1, and similar proteins, may have important roles in the initial phase of fungal fruiting, such as hyphae aggregation ... (B) The samples were ultracentrifuged and the sediments and supernatants obtained were analyzed (A) lane 1, Pharmacia low molecular mass standards; lane 2, ostreolysin (noncentrifuged); lane 3, ... reducing agents The samples were analyzed by SDS/PAGE using an 825% gradient polyacrylamide gel (Phast System; Pharmacia); gels were double stained, rst with Coomassie Blue and then, after destaining,...

Ngày tải lên: 23/03/2014, 21:20

12 492 0
Báo cáo Y học: Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles A possible role in membrane secretion pptx

Báo cáo Y học: Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles A possible role in membrane secretion pptx

... 5¢-ATTCTAGAG GCTAGGTTGTTGGAAAG-3¢, 5¢-ATTCTAGAGGAT GTCTTGAGCCCCTG-3¢ and 5¢-TTCTCGAGCAGGA CTGAGCATTAACAG-3¢ The two DNA fragments were ligated at the XbaI site and inserted into a cloning vector pBluescript ... domain was then amplified by PCR from the cloned plasmid with primers containing an EcoRI site at the 5¢ end (5¢-TAGAATTCCACCATGCAGGTCTCCCGT-3¢) and an EcoRV site at the 3¢ end (5¢-CAGATATCTTAACAGC ... Okayama, H (1987) High-efficiency transformation of mammalian cells by plasmid DNA Mol Cell Biol 7, 2745–2752 25 Aoki, N., Kuroda, H., Urabe, M., Taniguchi, Y., Adachi, T., Nakamura, R & Matsuda,...

Ngày tải lên: 24/03/2014, 03:21

10 517 0
Báo cáo khoa học: The histidine-phosphocarrier protein of Streptomyces coelicolor folds by a partially folded species at low pH ppt

Báo cáo khoa học: The histidine-phosphocarrier protein of Streptomyces coelicolor folds by a partially folded species at low pH ppt

... the calculated erfc)1(r) to the above equation by linear least-squares analysis was carried out with KALEIDAGRAPH (Abelbeck software) working on a PC computer Once the calibration parameters are ... (Fig 1A) showed a sigmoidal behaviour at low pH, and a plateau region above pH The maxima wavelength followed the same pattern than the The apparent pKa was 3.2 ± 0.3 (Fig 1A) The protein ... were carried out by using the general curve fit option of KALEIDAGRAPH (Abelbeck software) Gel filtration chromatography Analytical gel filtration experiments were carried out by using an analytical...

Ngày tải lên: 31/03/2014, 01:20

14 353 0
Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

... respiratory tract haemagglutinin-specific IgA antibodies in protection against influenza Vaccine 1990, 8:479-485 Tamura SI, Asanuma H, Ito Y, Hirabayashi Y, Suzuki Y, Nagamine T, Aizawa C, Kurata ... mediation of murine nasal anti-influenza virus immunity J Virol 1991, 65:2146-2148 Tamura S, Funato H, Hirabayashi Y, Kikuta K, Suzuki Y, Nagamine T, Aizawa C, Nakagawa M, Kurata T: Functional ... e-max ELISA reader and analyzed with Softmax Pro software (both Molecular Devices, Sunnyvale, CA) Statistical analyses Prism software [64] was used for plotting and statistical analysis of data...

Ngày tải lên: 18/06/2014, 18:20

14 516 0
báo cáo hóa học: " Serum antibodies from Parkinson''''s disease patients react with neuronal membrane proteins from a mouse " ppt

báo cáo hóa học: " Serum antibodies from Parkinson''''s disease patients react with neuronal membrane proteins from a mouse " ppt

... PBS, washed again, and then sera was added at a 1:100 dilution in 20% normal goat serum in PBS Plates were again washed, and alkaline-phosphatase-conjugated goat anti-human IgG (H + L) (Jackson ... r2 value was assessed by linear regression analysis (SigmaPlot 2000) and the significance (p) was calculated by Pearson correlation analysis with SigmaStat (Jandel Corp) microglia and 1% human ... was supported, in part, by an American Parkinson Disease Association Fellowship (VCH, N1402031) and DOD grant and U.S Army Medical Research and Materiel Command Neurotoxin Exposure Program Award...

Ngày tải lên: 19/06/2014, 22:20

9 359 0
Báo cáo hóa học: " Retrograde transport pathways utilised by viruses and protein toxins" potx

Báo cáo hóa học: " Retrograde transport pathways utilised by viruses and protein toxins" potx

... clathrin, dynamin II, and ARF6 The viruses were internalized in small vesicles and transported to membranebound, neutral pH organelles similar to caveosomes but lacking the caveolar markers cav-1 and ... causes fusion of Golgi and ER membranes, and thus disrupts both anterograde and retrograde trafficking between these organelles These results appear to implicate the Golgi apparatus as a staging ... Golgi stack in a CTx-like manner Bypassing the TGN and Golgi stack Details of the pathways taken by SV40 and Py to reach the ER are still under investigation After infection Py can be co-localized...

Ngày tải lên: 20/06/2014, 01:20

10 362 0
Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps

Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps

... gene transfer in the treatment of chronic articular disease Indeed, IL-1Ra gene therapy has demonstrated impressive efficacy in animal models of RA and OA, and a phase I human trial has recently ... Recombinant human IL-1Ra and human IL-1Ra synthesized transgenically in mammalian cells are equipotent antagonists of human IL-1β Our data indicate that the greater efficiency noted for transgenic ... cellular level, the advantage of gene transfer as a means of drug delivery arises from the sustained availability of IL-1Ra that this method permits Materials and method Materials Ham’s F12 medium,...

Ngày tải lên: 09/08/2014, 01:23

9 422 0
w