core competencies of a marketing manager

The Marketing Strategy of a multinational join stock company.doc

The Marketing Strategy of a multinational join stock company.doc

... The Marketing Strategy of a multinational join stock company multinational join stock company has a certain advantage: a multinational join stock company has always kept its prices as competitive ... basic characteristic about product, which was described by color, trademark, and the package of product. Each of the products of a multinational join stock company has a separate trademark and ... another main task of the department. ã Financial and Accounting department: this department deals with all financial and accounting matters. Another main function is to manage the use of capital to...

Ngày tải lên: 27/10/2012, 16:51

25 624 8
596 THE USE OF RELATIONSHIP MARKETING TECHNIQUES IN HIGHER EDUCATION  A CASE STUDY

596 THE USE OF RELATIONSHIP MARKETING TECHNIQUES IN HIGHER EDUCATION A CASE STUDY

... Chiến lược Marketing 6 1.1.3.3 Chiến Lược Marketing du lịch .7 1 1 . . 2 2 Vai trò c a chiến lược Marketing du lịch đ a phương 7 1.2.1 V V a a i i t t r r ò ò c c ủ ủ a a c c h h i i ế ế n n ... đ đ ị ị a a p p h h ư ư ơ ơ n n g g : : Nhiệm vụ c a ban quản lý Marketing rõ ràng là quan trọng cho việc hiểu vai trò c a Marketing bên trong doanh nghiệp. Tuy nhiên, điều nhà chiến lược quan ... đặc biệt quan trọng trong đ a bàn du lịch trọng điểm Nha Trang - Ninh Chữ - Dalat và là cực hút lớn củ a tam giác tăng trưởng du lịch Thành phố Hồ Chí Minh - Dalat - Nha Trang, xa hơn là trục...

Ngày tải lên: 08/04/2013, 17:02

162 1,1K 2
Tài liệu Improving Child Health in Cambodia: Social Marketing of Diarrhea Treatment Kit, Results of a Pilot Project pdf

Tài liệu Improving Child Health in Cambodia: Social Marketing of Diarrhea Treatment Kit, Results of a Pilot Project pdf

... critical in urban and peri-urban areas where caregiv- ers have more access to financial means and greater availability of alternative treatments. Lesson 4: The availability of anti-diarheal products ... in rural areas of Siem Reap and Pursat. The partnerships also facilitated an extensive training program of partners and providers on diarrheal disease, pre- vention, and treatment, and the ... 12 www.casesjournal.org To increase acceptability of the product, messages also emphasized the fact that the Orasel tasted better than the available ORS and that the zinc had a sweet taste. Village...

Ngày tải lên: 12/02/2014, 19:20

19 439 1
Tài liệu A spoonful of progress in a bowl full of unhealthy marketing to children docx

Tài liệu A spoonful of progress in a bowl full of unhealthy marketing to children docx

... Puffs Barbara’s Bakery Family 58 46 Purely O’s Cascadian Farm Family 58 52 Puffins Barbara’s Bakery Family 58 new Life Crunchtime Quaker Family 59 58 Average nutrition score for adult-targeted ... Cascadian Farm Child 53 50 Bunnies Annie’s Family 53 53 Life Quaker Family 54 51 Kix General Mills Family 54 new Chocolate O's Cascadian Farm Family 55 56 Kashi Squares Kashi Family ... Fruitful O's Cascadian Farm Family 50 50 Shredded Oats - Cinnamon Crunch Barbara’s Bakery Family 51 52 Envirokidz Organic Nature’s Path Family 52 50 Dora the Explorer General Mills...

Ngày tải lên: 18/02/2014, 02:20

4 397 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... because of the absence of the catalytic subunit ISP (Table 1). Figure 3A shows that a band of approximately 500 kDa was also found in this mutant strain when the mitochondrial membranes were ana- lyzed ... deletion in Saccharomyces cerevisiae. Nucleic Acids Res 21 , 3329–3330. 45 Ito H, Fukuda Y, Murata K & Kimura A (1983) Transformation of intact yeast cells treated with alkali cations. J Bacteriol ... but also in other organisms, such as Neurospora crassa [13], mammals [11] and plants [14]. A higher-order organization of the respiratory chain complexes was first proposed for bacterial respiratory...

Ngày tải lên: 18/02/2014, 08:20

15 640 0
A Synopsis of Social Marketing by Lynn MacFadyen, Martine Stead and Gerard Hastings (1999) pot

A Synopsis of Social Marketing by Lynn MacFadyen, Martine Stead and Gerard Hastings (1999) pot

... Organisational change Deter retailers 'Socio-cultural evolution' Eradication of Kotler P, Zaltman G (1971). Social marketing: an approach to planned social change. Journal of Marketing, ... Many social and health problems have behavioural causes: the spread of AIDS, traffic accidents and unwanted pregnancies are all the result of everyday, voluntary human activity. The most dramatic ... Kotler and Levy’s ideas into practice. Journal of Marketing Management, 13(4): 315-325. Lawther S, Lowry R (1995). Social marketing and behaviour change among professionals. Social Marketing Quarterly,...

Ngày tải lên: 06/03/2014, 21:20

10 1K 0
Components of Software Development Risk: How to Address Them? A Project Manager Survey ppt

Components of Software Development Risk: How to Address Them? A Project Manager Survey ppt

... proponents of software risk management, information about the impact of software risk management has been sparse and anecdotal. There are only a few empirical studies about the commonality and type of software ... identification of risks that are often organizationally sensitive. It demands more courage to air such risks if organizationally accepted risk management procedures are not available. Interestingly, managers ... resource usage and deadline effect. The other items loading to this factor are: evaluation of performance require- ments, managing project complexity, and estimation of hardware and software capabilities....

Ngày tải lên: 07/03/2014, 00:20

15 665 0
A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable Livelihoods Approach potx

A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable Livelihoods Approach potx

... sources of employment. Natural capital Natural capital is the quality and quantity of natural resources that are available to people and above all, the access and control people have over these natural ... livelihoods. Capital assets Capital assets are resources that help people survive and thrive. The main capital assets are natural, human, social, physical and financial capital (e.g. fishing skills, aquatic ... developed. By the end of the decade, there was a range of RRA methods and approaches available which then gave rise to participatory rural appraisal (PRA) at the beginning of the 1990s. In addition to...

Ngày tải lên: 07/03/2014, 00:20

95 646 0
Hollywood on the Head of a Pin: Montage and Marketing at the Oscars® docx

Hollywood on the Head of a Pin: Montage and Marketing at the Oscars® docx

... nominated films), while papering the “MediaSpace” of advocacy marketing (the hallowed hall of the Academy Awards telecast venue itself) with a naturalization of cinema as performance a move ... as paradigmatic television about cinema. The appeal of the montages as marketing tools for global cinema has less to do with an internal persuasiveness than with a nostalgic reassurance that ... problematized in the era of the global popular film market, is also a magic word. At once a place in Los Angeles, an industrial marker and a mythical land, it is emblematic of contemporary cinema’s...

Ngày tải lên: 07/03/2014, 15:20

10 612 0
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

... Lipo-oligo- saccharide of Campylobacter lari type strain ATCC 35221. Structure of the liberated oligosaccharide and an associated extracellular polysaccharide. Carbohydr. Res. 279, 245–264. 1766 A. D. Cox et al.(Eur. ... revealed glucitol, galactitol, glucosaminitol and L -glycero- D -manno-heptitol in approximately equimolar ratios. Sugar analysis of the LPS-derived alditol acetates from the galE mutant of strain ... O-deacylated lipid A (Lipid A- OH) is as indicated. Lipid A- OH consists of two glucosamine residues each bearing an N-linked 3-OH C 14:0 fatty acid and a phosphate group. Variation in lipid A- OH...

Ngày tải lên: 08/03/2014, 02:20

8 361 1
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

... immunoprecipi- tated with antisera directed against P48 and TF, analyzed on SDS/ PAGE and visualized with a PhosphorImager. (B) Quantification of data presented in panel (A) , after correction for translation ... a- helical core region as indicated. The leader peptidase cleavage site is depicted with an arrow. Table 1. Bacterial strains and plasmids used in this study. Ts, temperature sensitive. Cam r and Amp r , ... directed against SecA, indicating that it is a complex of the radiolabeled (G-10L)94PhoE and SecA (Fig. 4B, lane 1). In addition, cross-linking adducts of  220 kDa and  40 kDa were also immunoprecipitated from...

Ngày tải lên: 08/03/2014, 09:20

8 547 0
A study of translation of English marketing terms into Vietnamese

A study of translation of English marketing terms into Vietnamese

... translation and translation of Marketing terms: translation theory with definitions, methods, and its equivalent and translation of marketing terms including translation of ESP, technical translation. ... primary meaning may differ. The SL grammatical forms are converted to their nearest target language equivalents. However, the lexical words are again translated out of context. Literal translation ... linguistics and translation studies, mistakes in the course of analysis are unavoidable. Finally, a part of terms selected for analysis are somewhat not updated, which might affect comprehensiveness of...

Ngày tải lên: 18/03/2014, 00:21

49 629 3
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt

Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt

... MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut B Mut C Mut D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... 5Â-GGCGGATCCAAGCCAGTGGTTGTTAAT AC-3Â and 5Â-GCCTCGAGAATCAAGTGTCCCTGCACC T-3Â (LIN-54-DN); 5Â-GCGGATCCGAGGTGGTGCCAG CTGAG-3Â,5Â-GCTCTAGAGAATGGAAGCCGTGCCT G-3Â,5Â-GCTCTAGATTGGCAGATGCAGCTGAAGTA- 3Â and...

Ngày tải lên: 23/03/2014, 04:20

14 456 0
w