conversion of dc to ac

Báo cáo khoa học: Induction of PPARb and prostacyclin (PGI2) synthesis by Raf signaling: failure of PGI2 to activate PPARb potx

Báo cáo khoa học: Induction of PPARb and prostacyclin (PGI2) synthesis by Raf signaling: failure of PGI2 to activate PPARb potx

... proliferator-activated receptor delta, an integrator of transcriptional repression and nuclear receptor signaling Proc Natl Acad Sci USA 99, 2613–2618 Raf induction of PGI2 synthesis in the absence of ... treatment of N-BxB-ER cells would lead to an activation of the transcriptional activity of PPARb To address this question we constructed a luciferase reporter construct consisting of seven LexA ... transcriptional activation of PPARb The addition of pure PGI2 (10 lm) to the culture medium of Chinese hamster ovary cells did not alter the transcriptional activity of PPARb to any significant...

Ngày tải lên: 07/03/2014, 12:20

10 434 0
Chương 2: Sự biến đổi của thịt sau giết mổ - The Conversion of Muscle to Meat potx

Chương 2: Sự biến đổi của thịt sau giết mổ - The Conversion of Muscle to Meat potx

... Chương Sự biến đổi thịt sau giết mổ The Conversion of Muscle to Meat pH 7.0- 7.0 6.5- D.F.D 6.5 6.0- Bình thường 6.0 5.8 5.5 5.3 5.0 5.5- P.S.E 5.0- ... giải phóng enzym hủy - acid nhân xanthin, hypoxanthin; - protein tích aa (lys, gly…) + tạo thành acid glutamic từ arg, his, gln tạo hương vị - glycogen tích lũy đường đơi, pentose, ester Các yếu ... tạp đơn giản tăng WHC mềm Biến tính phân hủy protein vỡ cấu trúc Alpha actinin vạch Z - Calpain, calpastatin & calcium activated sarcoplasmic protease) Sự phân hủy proteoglycan – liên kết sợi...

Ngày tải lên: 16/03/2014, 14:20

70 3,1K 31
book of exercises to accompany e. friedrich richter's manual of simple and double counterpoint (1888)

book of exercises to accompany e. friedrich richter's manual of simple and double counterpoint (1888)

... first to have acquired the requisite execution in order to justice to the works of the masters, so also should one he a thorough master of coun- — — make proper use of one's ideas I thereon to the ... exercises oflFer difficulties in various directions The peculiar course of many of the melodies will easily mislead to forced progressions Then, too, we have to pay attention to the leading not only of ... transposed to G^msgor.) ^ i^^^^^ii -X No zsz =|Eg=7fe^p^g q=^ -

Ngày tải lên: 29/05/2014, 21:00

73 277 0
Conversion of Decimal to any Base ppt

Conversion of Decimal to any Base ppt

... textBox2, and textBox3 c Place a button control named button1 and set its Text property to To Base� d Place another button control named button2 and set its Text property to To Base� Write the following ... in the click event of the buttons as follows: On clicking the first button, you can convert a decimal number to any base you select in the ComboBox Collapse private void button1_Click(object sender, ... cHexa.GetValue(i).ToString(); for(int i=sBase.Length-1; i>=0; i ,iProduct *= numbase) { string sValue = sBase[i].ToString(); if (sValue.IndexOfAny(cHexa) >=0) b=iHexaNumeric[sHexa.IndexOf(sBase[i])];...

Ngày tải lên: 08/08/2014, 20:20

5 215 0
Báo cáo sinh học: "Mechanisms of resistance to acrolein in Drosophila melanogaster" ppt

Báo cáo sinh học: "Mechanisms of resistance to acrolein in Drosophila melanogaster" ppt

... an ANOVA, with factors and levels per factor, is used to analyse the results after an arcsin transformation, the following facts are clear First of all, in every case the effects of treatment temperature ... respect to acrolein resistance females, are not The mean values for ALDH activity, detected in the soluble fraction of acroleinresistant and control lines are displayed in Table Va: each of the ... increase of acrolein resistance (Sierra and Comendador, 1989) Locomotor activity The results of the mobility tests are shown in Table III In of the blocks (I and II) the flies from the acrolein-resistant...

Ngày tải lên: 14/08/2014, 20:20

10 315 0
Ecotourism:  One Means of Attempting to Achieve Sustainability

Ecotourism: One Means of Attempting to Achieve Sustainability

... and diffusion of innovation from Global South to Global North •Much to learn and draw from success stories in developing countries “Nature tourism involves travel to unspoiled places to experience ... cent of jobs globally Tourism Ecotourism has become the most rapidly growing and most dynamic sector of the tourism market >one-third of the U.S traveling public had taken at least one ecotour ... traditional vacation getaways” to places like Cancun and the Canary Islands - Lindsay (2003) Profile of Ecotourists: Most are between 31 and 50 years of age, equally divided by gender, and physically active...

Ngày tải lên: 23/06/2016, 21:30

28 674 0
Application of Hydrothermal Reaction to Biodegradability Improvement of Refractory Pollutants: Structural Conversion of Di- and Trichloroacetic Acid to Biodegradable Products

Application of Hydrothermal Reaction to Biodegradability Improvement of Refractory Pollutants: Structural Conversion of Di- and Trichloroacetic Acid to Biodegradable Products

... maximum operational conditions of both reactors are 450 oC and 45 MPa Reactor takes to reach 250 oC starting at room temperature While, reactor requires 1.5 to reach the same temperature The heat-up ... the experiments, reaction pressure was verified using the pressure gauge attached the batch reactor apparatus In each experiment, sample was placed into the reactor The reactor was sealed, and ... the number of attached chlorine atoms, regardless of the concentration of refractory parts in CAAs The results could be applied as basic data to the treatment of Chlorinated refractory pollutants...

Ngày tải lên: 05/09/2013, 08:40

8 644 0
Báo cáo y học: " Conversion of amino-acid sequence in proteins to classical music: search for auditory patterns" doc

Báo cáo y học: " Conversion of amino-acid sequence in proteins to classical music: search for auditory patterns" doc

... portion of this sequence fixed to a 20-note range (2.5 octaves), where each amino acid was initially assigned to a unique note One way to improve the musicality is to express each amino acid as ... assigned to unique parts of the genome, such as regulatory, intergenic, and promoter/operator sequences, in order to use the obvious distinction as a teaching tool for introducing the function of the ... converting genomic sequences into music, we hope to achieve several goals, which include investigating sequences by the vision impaired Another aim is to attract young people into molecular genetics by...

Ngày tải lên: 14/08/2014, 07:21

4 165 0
Study on extraction, conversion of hydroxycitric acid from leaves and fruit rinds of Garcinia oblongifolia Champ.ex Benth and its application to produce weight-loss products

Study on extraction, conversion of hydroxycitric acid from leaves and fruit rinds of Garcinia oblongifolia Champ.ex Benth and its application to produce weight-loss products

... result of extracted acid efficiency For hours of extraction with methanol solvent, the extracted 16 amount of acid is 10.49%, and 13.71% with acetone solvent 3.4 STUDY OF METABOLIC PROCESS OF CREATING ... the independence of total amount of collected acid, HCA, CA based on the age of G Oblongifolia fruit The total amount of acid, HCA and Citric acid in 06 samples of the green to ripe fruit rinds ... release of (-)-HCA The extract was passed through a cation exchange column to yield a free acid Bhabani S Jena et al (2002) exacted acid of rind fruits of G Cowa by using soxhlet method with aceton...

Ngày tải lên: 07/05/2015, 21:00

28 371 0
CONVERSION OF LEVULINIC ACID TO GAMMA VALEROLACTONE USING p CYMENE RU(II) n HETEROCYCLIC CARBENE COMPLEXES

CONVERSION OF LEVULINIC ACID TO GAMMA VALEROLACTONE USING p CYMENE RU(II) n HETEROCYCLIC CARBENE COMPLEXES

... NMR traces) Complex was isolated by column chromatography with DCM: acetone to yield 17% of dull yellow solid In the H NMR spectrum of in d3-acetonitrile, the bridging ethylene CH2 protons in ... Conversion of LA to GVL using p-cymene Ru(II) NHC Complexes [17n] Scheme Reaction pathways of LA to GVL Scheme Conversion of LA to GVL using molecular H2 or FA as the hydrogen source Page Conversion of ... Figure Derivatives of levulinic acid Page Conversion of LA to GVL using p-cymene Ru(II) NHC Complexes Of the wide range of derivatives that can be obtained from LA, γ-valerolactone (GVL) has been...

Ngày tải lên: 01/10/2015, 17:27

121 300 0
CONVERSION OF LEVULINIC ACID TO GAMMA VALEROLACTONE USING p CYMENE RU(II) n HETEROCYCLIC CARBENE COMPLEXES

CONVERSION OF LEVULINIC ACID TO GAMMA VALEROLACTONE USING p CYMENE RU(II) n HETEROCYCLIC CARBENE COMPLEXES

... NMR traces) Complex was isolated by column chromatography with DCM: acetone to yield 17% of dull yellow solid In the H NMR spectrum of in d3-acetonitrile, the bridging ethylene CH2 protons in ... Conversion of LA to GVL using p-cymene Ru(II) NHC Complexes [17n] Scheme Reaction pathways of LA to GVL Scheme Conversion of LA to GVL using molecular H2 or FA as the hydrogen source Page Conversion of ... Figure Derivatives of levulinic acid Page Conversion of LA to GVL using p-cymene Ru(II) NHC Complexes Of the wide range of derivatives that can be obtained from LA, γ-valerolactone (GVL) has been...

Ngày tải lên: 03/10/2015, 21:57

121 281 0
CONVERSION OF LEVULINIC ACID TO GAMMA VALEROLACTONE USING p CYMENE RU(II) n HETEROCYCLIC CARBENE COMPLEXES

CONVERSION OF LEVULINIC ACID TO GAMMA VALEROLACTONE USING p CYMENE RU(II) n HETEROCYCLIC CARBENE COMPLEXES

... NMR traces) Complex was isolated by column chromatography with DCM: acetone to yield 17% of dull yellow solid In the H NMR spectrum of in d3-acetonitrile, the bridging ethylene CH2 protons in ... Conversion of LA to GVL using p-cymene Ru(II) NHC Complexes [17n] Scheme Reaction pathways of LA to GVL Scheme Conversion of LA to GVL using molecular H2 or FA as the hydrogen source Page Conversion of ... Figure Derivatives of levulinic acid Page Conversion of LA to GVL using p-cymene Ru(II) NHC Complexes Of the wide range of derivatives that can be obtained from LA, γ-valerolactone (GVL) has been...

Ngày tải lên: 04/10/2015, 07:59

121 211 1
Báo cáo y học: " Eradication rate of Helicobacter pylori according to genotypes of CYP2C19, IL-1B, and TNF"

Báo cáo y học: " Eradication rate of Helicobacter pylori according to genotypes of CYP2C19, IL-1B, and TNF"

... of Helicobacter pylori infection by a 1-week regimen of proton pump inhibitor, amoxicillin and clarithromycin Aliment Pharmacol Ther 2003; 17: 259-65 Miki I, Aoyama N, Sakai T, et al Impact of ... underlined are the bases of the single nucleotide polymorphism Genomic DNA (30ng to 100ng) was used per 25μl of reaction with 0.18mM dNTPs, 12.5 pmol of each primer, 0.5 units of "AmpliTaq Gold", ... (dichotomous) and age (a continuous variable) using an unconditional logistic regression model Results Table describes the backgrounds of the whole visitors and participants From July 2004 to October...

Ngày tải lên: 31/10/2012, 16:57

6 650 1
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)

In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)

... ngữ to n dân đòa phương cụ thể với nét khác biệt so với ngôn ngữ to n dân hay với phương ngữ khác “[8; 24] Ở đây, thấy cần phân biệt ngôn ngữ to n dân phương ngữ Phương ngữ biến thể ngôn ngữ to n ... chỉnh riêng “một nhánh tách từ thân cây” [8; 54] ngôn ngữ to n dân Ngôn ngữ to n dân trừu tượng phương ngữ cụ thể “Phương ngữ ngôn ngữ to n dân có mặt trừu tượng mặt cụ thể ” [8; 54] 1.1.4.1.2 ... diễn đạt Về ngữ pháp, ngôn ngữ to n dân phương ngữ có lẽ không khác Chính thống mặt ngữ pháp phương ngữ với với ngôn ngữ to n dân thếø tiếng Việt bảo đảm thống to n quốc “Khi việc miêu tả thu...

Ngày tải lên: 17/04/2013, 16:09

137 855 0
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

... Most eubacteria Most eubacteria, archaebacteria Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ ... Candidatus ‘Accumulibacter phosphatis’ Most eubacteria Planctomycetales Verrucomicrobiales Sequence (5'!3') AGAGTTTGATCCTGGCTCAG GGCTACCTTGTTACGACTT CTGGAGTTTGGCAGAGGG GTTAGCTACGGCACTAAAAGG CCGTCATCTACWCAGGGTATTAAC ... quantification in activated sludge It would be suitable for routine monitoring or measurement of a large number of samples, and lead to better understanding of the contribution of Candidatus ‘Accumulibacter...

Ngày tải lên: 05/09/2013, 09:38

7 720 0
Alternate strategies for conversion of waste plastic to fuels

Alternate strategies for conversion of waste plastic to fuels

... Solid acid catalysts, such as zeolites, favor hydrogen transfer reactions due to the presence of many acid sites [3, 5] Both Bronsted and Lewis acid sites characterize acid strength of solid acids ... France, and the United States of America According to the government of India, import data of more than 59,000 tons and 61,000 tons of plastic waste have found its way into India in the years 1999 ... acids The presence of Bronsted acid sites supports the cracking of olefinic compounds [3, 19].The majority of the acid sites in crystalline solid acids are located within the pores of the material,...

Ngày tải lên: 27/11/2013, 21:35

8 537 0
Tài liệu Enumeration of Kinematic Structures According to Function P2 doc

Tài liệu Enumeration of Kinematic Structures According to Function P2 doc

... each edge has two end vertices, there are exactly two nonzero elements in each column Hence, the sum of each column is always equal to 2, whereas the sum of each row is equal to the degree of ... of the number of spanning trees in a graph [2] THEOREM 2.4 Let A be the adjacency matrix of a connected graph G Then all cofactors of the matrix M are equal, and their common value is equal to ... and enumeration of graphs © 2001 by CRC Press LLC 2.7.1 Adjacency Matrix To facilitate the study, the vertices of a graph are labeled sequentially from to v A vertex -to- vertex adjacency matrix,...

Ngày tải lên: 17/12/2013, 13:15

26 380 0
Tài liệu Enumeration of Kinematic Structures According to Function P3 pptx

Tài liệu Enumeration of Kinematic Structures According to Function P3 pptx

... are perpendicular to each other with an offset distance Both mechanisms are capable of converting the rotational motion of link into the reciprocating and oscillatory motions of link These two ... study of the nature of connection among various links of a kinematic chain is called the structural analysis or topological analysis To facilitate the analysis, several methods of representation of ... to n Since in the graph, representation vertices correspond to links and edges correspond to joints, the link -to- link adjacency matrix, A, is defined as follows: aij = if link i is connected to...

Ngày tải lên: 17/12/2013, 13:15

18 406 0
Tài liệu Enumeration of Kinematic Structures According to Function P4 ppt

Tài liệu Enumeration of Kinematic Structures According to Function P4 ppt

... and Graphs Graph Number of vertices Number of edges Number of vertices of degree i Degree of vertex i Number of independent loops Total number of loops (L + 1) Number of loops with i edges Symbol ... of Freedom The degrees of freedom of a mechanism is perhaps the first concern in the study of kinematics and dynamics of mechanisms The degrees of freedom of a mechanism refers to the number of ... degrees of freedom of a mechanism to the number of links, number of joints, and type of joints It is also possible to establish an equation that relates the number of independent loops to the...

Ngày tải lên: 17/12/2013, 13:15

35 361 0
w