chemical synthesis of lipid a and analogues

Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 1 4

Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 1 4

... were washed with 10 mL of 5% NaHCO3, water and brine The organic layer was dried over Na2SO4 and the solvent was removed on a rotary evaporator After silica gel chromatography 18.0 mg of a yellow ... concentrated by rotary evaporation The crude extract was partitioned between 1:2 (v/v) acetonitrile and hexanes and the acetonitrile layer was collected and dried via rotary evaporation to deliver a ... organic layers were washed with 10 mL water and brine The organic layer was dried over Na2SO4 and the solvent was removed on a rotary evaporator The resulting crude material was not purified as...

Ngày tải lên: 10/09/2015, 15:48

142 421 0
Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 5

Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 5

... 232.3 O 338 Appendix HO O 5-33 C14H16O3 232.3 OH FT-IR Data 339 AcO O O 5-32 C16H18O4 274.3 340 Appendix AcO O OAc 5-35 C18H20O5 316.3 FT-IR Data 341 AcO O 5-38 C18H20O6 332.3 OAc O 342 Appendix ... 598.8 O TES FT-IR Data 333 HO OH 3-57 C16H22O3Si 290.4 O TES 334 Appendix HO O 3-35 C16H22O3Si 290.4 O TES FT-IR Data 335 HO O 3-34 C10H7IO3 302.1 O I 336 Appendix FT-IR Data 337 HO O 5-28 C14H16O3 ... 320 Appendix FT-IR Data 321 OH O O HO O O O OH O OH O 2-1 C44H32O12 752.7 O OH O 5-2 C18H14O3 278.3 O 322 Appendix I OH 5-8 C8H7IO2 262.0 O FT-IR Data 323 I OTs 5-9 C15H13IO4S 416.2 O 324 Appendix...

Ngày tải lên: 10/09/2015, 15:49

30 265 0
Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 6

Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 6

... Appendix Low-Resolution-Mass Data AcO O OAc 5-35 C18H20O5 316.3 375 AcO O 5-38 C18H20O6 332.3 OAc O 376 Appendix Low-Resolution-Mass Data HO O 5-40 C14H16O4 248.3 O OH 377 378 Appendix ... Low-Resolution-Mass Data 353 OH O 5-2 C18H14O3 278.3 O 354 Appendix Low-Resolution-Mass Data 355 O 5-4 C36H24O4 520.6 O O O O O 5-6 C36H24O4 520.6 O O 356 Appendix Low-Resolution-Mass Data I OH 5-8 ... 302.1 O I 370 Appendix Low-Resolution-Mass Data 371 HO O 5-28 C14H16O3 232.3 O 372 Appendix Low-Resolution-Mass Data HO O 5-33 C14H16O3 232.3 OH 373 AcO O O 5-32 C16H18O4 274.3 374 Appendix Low-Resolution-Mass...

Ngày tải lên: 10/09/2015, 15:50

34 228 0
Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 7

Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 7

... O 410 Appendix O HO O 5-28 C14H16O3 232.1099 High-Resolution-Mass Data 411 O HO OH 5-33 C14H16O3 232.1099 412 Appendix O AcO O 5-32 C16H18O4 274.1205 High-Resolution-Mass Data 413 O AcO OAc 5-35 ... O OH O 386 Appendix High-Resolution-Mass Data 387 O O O O O O HO O O HO O 4-38 C48H38O14 838.2262 O OH O 388 Appendix High-Resolution-Mass Data 389 OH O 5-2 C18H14O3 278.0943 O 390 Appendix High-Resolution-Mass ... High-Resolution-Mass Data 395 O O OTs OTs OBn 5-10 C43H36O9S2 760.1801 396 Appendix O O OH OH OBn 5-11 C29H24O5 452.1624 High-Resolution-Mass Data 397 O O O O OBn 5-12 C29H24O5 452.1624 398 Appendix...

Ngày tải lên: 10/09/2015, 15:50

38 257 0
Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 8

Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 8

... cooperation with the Roche Diagnostics Department of Rare Reagents Hoechst AG, Frankfurt, Germany 1992 - 1995 Today part of the Sanofi-Aventis group Chemical Technician Apprenticeship and Qualification ... Programme (PhD student under the supervision of Dr Martin Lear) • Affinity-Guided Isolation, Structure Elucidation and Total Synthesis of Laetirobin A and Its Analogue Synthesis for Therapeutic ... Development of anti-malaria therapeutics Boehringer Ingelheim, Vienna, Austria Research Scientist – Cancer Research Work focused on ground-breaking kinase inhibitor research and has led to a patent...

Ngày tải lên: 10/09/2015, 15:50

12 185 0
Báo cáo Y học: Synthesis of phosphoenol pyruvate (PEP) analogues and evaluation as inhibitors of PEP-utilizing enzymes pot

Báo cáo Y học: Synthesis of phosphoenol pyruvate (PEP) analogues and evaluation as inhibitors of PEP-utilizing enzymes pot

... 3-Cl-PEP analogues 1c and 1d The last two isomers and the chlorinated analogues 2g and 3c are candidates for the irreversible inactivation of PEP-utilizing enzymes MATERIALS AND METHODS Enzyme I, and ... PEP analogues 1c,d, 2g and 3c in the presence of Mg2+, and were then assayed for residual catalytic activity with their natural substrates Inactivation of PEP carboxylase and enolase was also ... PEP carboxylase, and enolase Compounds 2a e, 2g–i and 3c are new, and for that reason their synthesis and characterization is also reported, as well as an improved method for the preparation of...

Ngày tải lên: 18/03/2014, 01:20

11 643 0
facile synthesis of porous a - fe2o3 nanorods and their application in ethanol sensors

facile synthesis of porous a - fe2o3 nanorods and their application in ethanol sensors

... nanorods to various gases of 50-1000 ppm area and a relatively large particle size, whereas the sensor based on porous R-Fe2O3 nanorods has a high surface area and tiny crystal size, which can provide ... heating rate of 10 °C min-1 X-ray diffraction (XRD) analysis was performed on a D/MAX-RAX diffractometer with Cu KR radiation (λ ) 0.154 18 nm) operating at 40 kV and 100 mA Diffraction peaks of ... micrographs of the as-prepared R-FeOOH sample, respectively The images clearly demonstrate that the sample has a smooth, rodlike morphology with average diameter of about 10-15 nm and a length of about...

Ngày tải lên: 19/03/2014, 16:48

5 458 1
Báo cáo khoa học: Increased sensitivity of glycogen synthesis to phosphorylase-a and impaired expression of the glycogen-targeting protein R6 in hepatocytes from insulin-resistant Zucker fa ⁄ fa rats pptx

Báo cáo khoa học: Increased sensitivity of glycogen synthesis to phosphorylase-a and impaired expression of the glycogen-targeting protein R6 in hepatocytes from insulin-resistant Zucker fa ⁄ fa rats pptx

... from fa ⁄ fa than Fa ⁄ ? rats and also that there is a rightward shift in the plots of glycogen synthesis against phosphorylase -a or glycogen synthase against phosphorylase -a in fa ⁄ fa compared ... kit (Amersham Pharmacia Biotech, Piscataway, NJ) Statistical analysis Results are expressed as means ± SE Statistical analysis was carried out using the Student’s t-test (either paired or unpaired) ... hepatocytes from fa ⁄ fa rats Hepatocytes from fa ⁄ fa rats had a higher total activity of glucokinase (Fa ⁄ ? ± munitsÆmg)1; fa ⁄ fa ± munitsÆmg)1 P < 0.01) and a higher proportion of this activity...

Ngày tải lên: 30/03/2014, 11:20

11 360 0
Báo cáo Y học: Structural study on lipid A and the O-specific polysaccharide of the lipopolysaccharide from a clinical isolate of Bacteroides vulgatus from a patient with Crohn’s disease ppt

Báo cáo Y học: Structural study on lipid A and the O-specific polysaccharide of the lipopolysaccharide from a clinical isolate of Bacteroides vulgatus from a patient with Crohn’s disease ppt

... Science and Culture of Japan (13670289 to T K.), grants and contracts from International Health Cooperation Research Ó FEBS 2002 (1 1A- 1) from the Ministry of Health and Welfare of Japan, and ÔResearch ... OPS-rich fraction (30%) Mainly two sugars, Rha and Man, were detected in the OPS-rich fraction on analysis of the sugar constituents (Table 1) The approximate molar ratio of Rha to Man was : Absolute ... spectra were estimated using DQFCOSY spectra; 9–10 Hz for 3J3,4 of residue a and 1–2 Hz for J1,2 of residue b The data are summarized in Table Residue a was assigned as a- L-rhamnopyranose (a- L-Rhap)...

Ngày tải lên: 31/03/2014, 23:20

7 437 0
Báo cáo lâm nghiệp: "Effects of the clear-cutting of a Douglas-fir plantation (Pseudotsuga menziesii F.) on the chemical composition of soil solutions and on the leaching of DOC and ions in drainage waters" pps

Báo cáo lâm nghiệp: "Effects of the clear-cutting of a Douglas-fir plantation (Pseudotsuga menziesii F.) on the chemical composition of soil solutions and on the leaching of DOC and ions in drainage waters" pps

... Ultrase) Total organic carbon (DOC) was measured on a SHIMADZU TOC 5050 Al speciation was periodically made according to Boudot et al [10] 2.4 Data base and procedure for treatment of data All ... data All eld and laboratory measurements and the model-generated data used for budget calculations were administrated by an Access database (Microsoft) using VBA programming Statistical procedures ... +61 and +73 kg ha1 year1 respectively for scenarios and (Tab VIIA) At 120 cm, an increase in K was observed by kg ha1 year1 for scenario and by 2.4 kg ha1 year1 for scenario A decrease was observed...

Ngày tải lên: 07/08/2014, 16:20

18 416 0
Báo cáo khoa học: "Influence of decaying wood on chemical properties of forest floors and surface mineral soils: a pilot study" pptx

Báo cáo khoa học: "Influence of decaying wood on chemical properties of forest floors and surface mineral soils: a pilot study" pptx

... in detail in Lowe (1974) and Lowe and Klinka (1981) Mineral soil samples were also analyzed for oxalate Fe and Al and dithionite Fe, Al and Si Oxalate Fe and Al were extracted using acid ammonium ... stand, and a tendency towards greater accumulation of amorphous inorganic aluminum and dithionite aluminum and iron occurred beneath decaying wood in the Douglas-fir stand ACKNOWLEDGMENTS The authors ... like to thank R Brant and V Breij of the Department of Physical Geography and Soil Science, University of Amsterdam, for the assistance in field work and initial data analysis Financial support...

Ngày tải lên: 08/08/2014, 19:21

11 389 0
Báo cáo y học: "Diacerein inhibits the synthesis of resorptive enzymes and reduces osteoclastic differentiation/survival in osteoarthritic subchondral bone: a possible mechanism for a protective effect against subchondral bone remodelling" ppsx

Báo cáo y học: "Diacerein inhibits the synthesis of resorptive enzymes and reduces osteoclastic differentiation/survival in osteoarthritic subchondral bone: a possible mechanism for a protective effect against subchondral bone remodelling" ppsx

... interpretation of data, manuscript preparation, and statistical analysis SKT participated in acquisition of data, analysis and interpretation of data, and manuscript preparation SC participated in acquisition ... preparation, and statistical analysis J-PP participated in study design, analysis and interpretation of data, and manuscript preparation JM-P participated in study design, analysis and interpretation ... acquisition of data and manuscript preparation All authors read and approved the final manuscript 13 14 15 16 Acknowledgements The authors thank Virginia Wallis for her assistance in manuscript preparation...

Ngày tải lên: 09/08/2014, 10:23

10 536 0
Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

... periplasmic space MATERIALS AND METHODS Materials, bacterial strains and proteins Starting materials for the preparation of compounds 1a) 3d, and other components were purchased from commercial sources ... biphasic to a monophasic shape are Table Rates of inactivation of IICBGlc Incubation of purified IICBGlc with the indicated concentration (mM) of the analogues 1a) 3d was carried out at 30 °C Rate ... reactive analogues and [14C]aMG or [14C]2dGlc were added in molar ratio of 10 : and the uptake of [14C]aMGlc via EIIGlc or of [14C]2dGlc via EIIMan was measured (Fig 4) The C-1 epoxide 3a was...

Ngày tải lên: 21/02/2014, 01:21

12 721 0
Tài liệu Báo cáo Y học: Dinucleoside polyphosphates stimulate the primer independent synthesis of poly(A) catalyzed by yeast poly(A) polymerase ppt

Tài liệu Báo cáo Y học: Dinucleoside polyphosphates stimulate the primer independent synthesis of poly(A) catalyzed by yeast poly(A) polymerase ppt

... part (B) of the figure After 30, 60 and 120 incubation at 37 °C, aliquots were taken and analyzed by HPLC as indicated in Materials and methods Relative activity of GpnGs as effectors of the synthesis ... that poly (A) was synthesized from ATP, in the absence of primer, and that Gp2G, Gp3G, and Gp4G stimulated that synthesis Stimulation of poly (A) synthesis as a function of diguanosine diphosphate ... carried out in duplicate (lanes C) The reaction mixtures were treated further with alkaline phosphatase and (after inactivation of the phosphatase) with phosphodiesterase and analyzed by TLC as...

Ngày tải lên: 21/02/2014, 01:21

7 475 0
Báo cáo khoa học: Detailed structure of lipid A isolated from lipopolysaccharide from the marine proteobacterium Marinomonas vaga ATCC 27119T pot

Báo cáo khoa học: Detailed structure of lipid A isolated from lipopolysaccharide from the marine proteobacterium Marinomonas vaga ATCC 27119T pot

... presence of two molecular forms of the lipid A studied Characterization of the fatty acid moiety of M vaga lipid A Fatty acid analysis of the lipid A studied revealed the presence of decanoic acid ... accordance with the Pacific Institute of Bioorganic Chemistry Policy on Human Care and Use of Laboratory Animals Fig TLC of M vaga ATCC 27119T lipid A before (1) and after (2) fractionation Table ... groups at C3¢, C4, C4¢, and C6¢ are free As GLC and GLC/MS data show, the M vaga lipid A contains unsaturated D5-C12 : acid (Table 1) In accordance with this, two carbon signals, at 131.22 and 128.44...

Ngày tải lên: 07/03/2014, 15:20

10 418 0
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

... DAnorm ¼ aa Á expðÀka Á ½O2 Š Á tÞ þ ab ÁexpðÀkb Á ½O2 ŠÁtÞ ð2Þ where DAnorm is a normalized change in optical density of the sample and aa, ab, k a and k¢b are the amplitudes and rate constants ... Lepeshkevich and B M Dzhagarov Fig Total oxygen affinity (K t) of liganded hemoglobin as a function of NaCl concentration Bars 1, and are the relative changes in Kt at pH 6.8, 7.4 and 8.5, respectively As ... between the values of the association rate constant of BR (k¢) and the quantum yield of BR (c) The data for the a and b subunits within liganded tetrameric HbA are shown in (A) and (B), respectively...

Ngày tải lên: 16/03/2014, 14:20

11 577 0
Báo cáo Y học: Structural determination of lipid A of the lipopolysaccharide from Pseudomonas reactans A pathogen of cultivated mushrooms doc

Báo cáo Y học: Structural determination of lipid A of the lipopolysaccharide from Pseudomonas reactans A pathogen of cultivated mushrooms doc

... information was available about the fatty acid distribution on the proximal GlcN Analysis of intact lipid A and ammonium hydroxide treated lipid A fractions The negative ion MALDI-TOF (Fig 4) mass ... Negative-ion MALDI-TOF mass spectrum of intact lipid A fraction from Ps reactans Fig Negative-ion MALDI-TOF mass spectrum of ammonium treated lipid A fraction from Ps reactans A combination of ... Geoffroy, V .A. , Alatossava, T & Meyer, J.M (2000) Application of siderotyping for characterization of Pseudomonas tolaasii and ÔPseudomonas reactansÕ isolates associated with brown blotch disease of cultivated...

Ngày tải lên: 24/03/2014, 00:21

8 314 0
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

... phylogenetic analysis Enzyme Species GenBank/EBI A transferase A transferase A transferase A (cis A/ B) transferase A- likea Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase ... cDNA corresponding to the A enzyme cDNA was performed with the following primers: CAGACGGATGTCCAGAAAGTTG and: GCTACAG GTACCGCCTCTCCAA Amplification was performed using the Advantage Polymerase ... protein)1 of either [14C]galactose or [14C]N-acetylgalactosamine transferred tion of cDNA and lack of contamination by genomic DNA A band at the expected size was detected in various tissues as indicated...

Ngày tải lên: 31/03/2014, 09:20

8 499 0
controlled synthesis of α fe2o3 nanorods and its size dependent optical

controlled synthesis of α fe2o3 nanorods and its size dependent optical

... shape-dependent optical absorption, electrochemical, and magnetic properties are investigated Experimental 2.1 Preparation of α-FeOOH and α-Fe2 O3 nanorods All reagents were analytically pure and used without ... α-FeOOH nanorods in air at 500 ◦ C for h at a heating rate of ◦ C/min, preserving the same rodlike morphology ASAP-2000 nitrogen adsorption apparatus The performance of the α-Fe2 O3 as a cathode was ... and S3 at K The coercivity forces of samples S1, S2, and S3 are 67, 146, and 584 Oe, respectively, indicative of soft magnets The remnant magnetizations of samples S1, S2, and S3 at K are determined...

Ngày tải lên: 05/05/2014, 15:26

9 434 0
w