characterization virus adsorption and antiviral effects of ag vimips

A study of elliptical vibration cutting in ultra precision machining

A study of elliptical vibration cutting in ultra precision machining

... reduced wear rate of diamond tools in VAM of steel: i) contamination of the tool/workpiece interface, and ii) generation of iron oxide vii List of Tables List of Tables Table 3.1 Cutting and vibration ... understanding of the transient cutting mechanics and for accurate prediction of the transient cutting force In this model, transient thickness of cut and transient shear angle are considered and ... fluoride, and (d) glass (Suzuki et al., 2004) 23 ix List of Figures Figure 2.12 SEM photographs of cutting edges of worn diamond tools: (a) after CVC of steel for 1000m, and (b) after EVC of steel...

Ngày tải lên: 09/09/2015, 10:21

175 652 0
Báo cáo khoa học: "Clinical review: The implications of experimental and clinical studies of recruitment maneuvers in acute lung injury" pptx

Báo cáo khoa học: "Clinical review: The implications of experimental and clinical studies of recruitment maneuvers in acute lung injury" pptx

... and the forces generated by repeated opening and collapse lead to upregulation of an inflammatory response, with release of cytokines and chemokines and activation of neutrophils and macrophages ... der Kloot and colleagues [17] studied the effects of RMs on gas exchange and lung volumes in three experimental models of ALI: saline lavage, oleic acid, and pneumonia After application of RMs, ... tidal volume and high PEEP However, when Bein and colleagues [37] analyzed the impact of RMs on intracranial pressure and cerebral metabolism in patients with acute cerebral injury and respiratory...

Ngày tải lên: 12/08/2014, 19:22

7 287 0
báo cáo hóa học:" Experimental and analytical validation of a modular acetabular prosthesis in total hip arthroplasty" pot

báo cáo hóa học:" Experimental and analytical validation of a modular acetabular prosthesis in total hip arthroplasty" pot

... mm (millimeter): Unit of Length equal to one 10-3 meters sec (Second): Unit of Time (SI) Page of (page number not for citation purposes) Journal of Orthopaedic Surgery and Research 2007, 2:7 ... acetabular shell, liner and femoFinite Element Model of the acetabular shell, liner and femoral head The liner locking mechanism was simulated constraining all degrees of freedom of the nodes located ... Element Model Page of (page number not for citation purposes) Journal of Orthopaedic Surgery and Research 2007, 2:7 http://www.josr-online.com/content/2/1/7 Table 1: Loading profile applied to...

Ngày tải lên: 20/06/2014, 00:20

9 439 0
High-Surface-Area Catalyst Design- Synthesis, Characterization, and Reaction Studies of Platinum Nanoparticles in Mesoporous SBA-15 Silica

High-Surface-Area Catalyst Design- Synthesis, Characterization, and Reaction Studies of Platinum Nanoparticles in Mesoporous SBA-15 Silica

... Director, Office of Energy Research, Office of Basic Energy Sciences, Materials and Chemical Sciences Divisions of the U S Department of Energy under Contract DE-AC03-76SF00098 We thank Professor ... degree of ethane dehydrogenation Dumesic and co-workers have conducted a number of theoretical studies of ethane adsorption on Pt clusters60,61 and slabs61 to investigate the interaction of possible ... C-C bond cleavage of the activated complexes of ethyl (C2H5) and ethylidene (CHCH3) are 44 and 39 kcal mol-1, respectively, compared with 61 and 79 kcal mol-1 for vinyl (CHCH2) and vinylidene...

Ngày tải lên: 08/10/2015, 23:16

11 471 0
Báo cáo vật lý: "Volumetric and Thermodynamic Studies of Molecular Interactions in Ternary Liquid Mixtures at 303, 308 and 313K" pptx

Báo cáo vật lý: "Volumetric and Thermodynamic Studies of Molecular Interactions in Ternary Liquid Mixtures at 303, 308 and 313K" pptx

... parameters and Xi are the mole fractions of the liquid components RESULTS AND DISCUSSION The experimentally determined values of the density (ρ), viscosity (η) and ultrasonic velocity (U) for all of ... associated by dipole-dipole interactions, and is of particular interest because of the absence of any significant structural effects due to the lack of hydrogen bonds; therefore, it may work ... were evidently due to the rupture of the hydrogen bonds in pure cyclohexanone and 1-alknaols and DMF-DMF, dipole-dipole interactions, and the formation of O–H…C=O and perhaps even O–H ….N(CH3)2...

Ngày tải lên: 07/08/2014, 14:20

13 258 0
Báo cáo y học: "Systematic review and meta-analysis of randomised trials and cohort studies of mycophenolate mofetil in lupus nephritis" pdf

Báo cáo y học: "Systematic review and meta-analysis of randomised trials and cohort studies of mycophenolate mofetil in lupus nephritis" pdf

... generally between and g daily The duration of follow-up of patients on MMF was generally between and 36 months, and average follow-ups were generally of year or longer None of the studies clearly ... with SLE, some of whom had lupus nephritis; of 284 patients studied, 63 had Table Outcomes of randomised trials Outcome Number of trials Number of patients Percentage with MMF Percentage with cyclophosphamide ... nephritis Number of Percentage events/patients with outcome Number of cohorts Any SLE patients Number of Percentage events/patients with outcome Number of cohorts Number of Percentage events/patients...

Ngày tải lên: 09/08/2014, 08:23

10 433 0
MOLECULAR AND PHYSIOLOGICAL STUDIES OF SALT TOLERANCE IN THE SALT SECRETOR MANGROVE AVICENNIA OFFICINALIS

MOLECULAR AND PHYSIOLOGICAL STUDIES OF SALT TOLERANCE IN THE SALT SECRETOR MANGROVE AVICENNIA OFFICINALIS

... 3’) AGATCTATGGAGAGCAAGGAGGA ACTAGTTCACTTGGACTTGAATG CTCGAGATGGAGAGCAAGGAGGA CCCGGGCTTGGACTTGAATG GGGCTTCGGCAAGACCCTGT GCGCTGCGTTTGGCATCAGT AGATCTATGGCTGAGGGCAAGG ACTAGTTTAGCATGCCCGGTTGC CTCGAGATGGCTGAGGGCAAGG ... CTCGAGATGGCTGAGGGCAAGG CCCGGGGCATGCCCGGTTGC GCTTTCCCTGACCAGGGCTC GCCCCTCCTTTAAGCCTCTG AGATCTATGGCTAAGGACATTG ACTAGTTCAGTAAGAAGAGCTCC CTCGAGATGGCTAAGGACATTG CCCGGGAGTAAGAAGAGCTCC ACATTGAGGTCGGAGCCACC ... GCCCCTCCTTTAAGCCTCTG PRS_FW CGCCGATGAGTGTTGGAAAC PRS_RV AAGAATCGCACATCCAGGCT CCO_FW GAGTCGAGGGTGTAATGCCG CCO_RV TCCAAAGGGACCAGATGGGT TR_FW ATTCTAAGCGCCGAGACTGG TR_RV AGAGGAGGACTAACAGCCCA DHN_FW...

Ngày tải lên: 09/09/2015, 08:13

218 765 0
Experimental and numerical modelling of spudcan penetration in stiff clay overlying soft clay

Experimental and numerical modelling of spudcan penetration in stiff clay overlying soft clay

... 5.6.1 Effects of H/B 137 5.6.2 Effects of cu2/cu1 137 5.6.3 Effects of γ1′/γ2′ 138 5.6.4 Effects of cu2/(γ2′B) 139 5.6.5 Effects of strain-softening ... lower-layer clay cu,avg Average of strengths of upper- and lower-layer clay cu2,D Strength of clay at depth of spudcan (D) cus Average soil strength over depth of excavation or depth of wished-in-place ... the lower average mobilised shear strength in the sand layer as a result of the strain-softening behaviour of the sand However, no measurements of the stress-strain behaviour of the sand were reported...

Ngày tải lên: 10/09/2015, 15:54

231 485 0
Experimental and theoretical studies of waste heat driven pressurized adsorption chillers

Experimental and theoretical studies of waste heat driven pressurized adsorption chillers

... consider the variation of the heat of adsorption as a function of loading, which in turn depends on the pressure and temperature at which adsorption/ desorption occurs The heat of adsorption, Qst can ... The nexus of an adsorption refrigeration system design is based upon the determination of adsorption isotherms and kinetics of adsorbent-adsorbate pair as well as the isosteric heat of adsorption ... (h), and internal energy (u) are described in term of pressure (P), temperature (T), and the amount of adsorbate uptake or surface coverage (q), where the effects of specific heat capacity and...

Ngày tải lên: 11/09/2015, 10:01

221 833 0
Optical and electrical studies of silicon nanowires in photovoltaic applications

Optical and electrical studies of silicon nanowires in photovoltaic applications

... respectively and a vertical tilt of 7° for every implant BF2 core implant was done with dose of 2.5 x 1013 cm-2 and energy of 80 keV; phosphorus shell implant was done with dose of 1015 cm-2 and energy of ... conditions of ultra-thin SiNWs 64 vii LIST OF FIGURES Fig (a) SEM cross-section image of 10 µm thick vertically aligned SiNW array produced by etching (b) SEM image (30° tilt) of randomly ... work, features and working principles of conventional planar Si solar cell and novel SiNW solar cell have been studied and compared, highlighting the advantages and promising prospect of SiNWs in...

Ngày tải lên: 12/10/2015, 17:35

92 397 0
Pharmacokinetic and pharmacodynamic studies of mycophenolic acid in renal transplant recipients

Pharmacokinetic and pharmacodynamic studies of mycophenolic acid in renal transplant recipients

... objective of identifying the pharmacokinetic profile of total and free mycophenolic acid (MPA), and mycophenolic acid glucuronide (MPAG) and pharmacodynamic profile of MPA in mycophenolate mofetil ... Scatter plot of free fraction of MPAG versus MPA concentration 90 4.5 Scatter plot of free fraction of MPAG versus MPAG concentration 90 4.6 Scatter plot of free fraction of MPA versus MPAG concentration ... (MPAG) 1.4 Metabolic pathways of mycophenolic acid in humans 1.5 Mechanism of action of MPA on IMPDH enzyme 13 1.6 Chemical structure of sirolimus (SRL) 22 1.7 Mechanism of action of MMF and...

Ngày tải lên: 28/11/2015, 13:44

207 246 0
Thermodynamics of cholesterol compounds in supercritical carbon dioxide  experimental and modeling studies

Thermodynamics of cholesterol compounds in supercritical carbon dioxide experimental and modeling studies

... 1970s for decaffeination of coffee and tea, refining of cooking oils, recovering of flavors and pungencies from spices, hops, and other plant materials A compilation of proven and potential applications ... data show the order of magnitude and one can note that the viscosity of a supercritical fluid is generally comparable to that of a gas but two orders of magnitude lower than that of a liquid whereas ... partial molar volume of solute in diluted supercritical solutions is of importance to the understanding of solute solubility and of relevance to the determination of the region of practical interest...

Ngày tải lên: 17/09/2015, 17:19

280 314 0
Báo cáo khoa học: "Experimental reproduction of proliferative enteropathy and the role of IFN-gamma in protective immunity against Lawsonia intracellularis in mice" pdf

Báo cáo khoa học: "Experimental reproduction of proliferative enteropathy and the role of IFN-gamma in protective immunity against Lawsonia intracellularis in mice" pdf

... γ-NFI yb dezilitu eb ton thgim noitcefni tsniaga decudorp γ-NFI eht ,revewoH ]7[ smsinagroorcim ralullecartni rehto fo esac eht ekil negohtap eht tsniaga sesnopser siralullecartni L siralullecartni ... deifitnedi AND pb-913 cificeps)B( lortnoc evitisop a ,7 ;IP 41 yad ,6 ;11 yad ,5 ;9 yad ,4 ;7 yad ,3 ;5 yad ,2 ;3 yad ,1 ;rekram AND pb-001 dradnats ,M :senaL secef eht ni RCP yb deifitnedi AND pb-913 ... siralullecartni L semit eerht detaeper saw tnemirepxe sihT ylevitcepser ,puorg lortnoc a rof dna puorg noitcefni na rof dengissa erew ecim eerhT esuom detcefnifo noloc dna mucec cimerepyh dna degralne...

Ngày tải lên: 07/08/2014, 18:21

3 481 0
Báo cáo y học: "Interaction of mumps virus V protein variants with STAT1-STAT2 heterodimer: experimental and theoretical studies" pps

Báo cáo y học: "Interaction of mumps virus V protein variants with STAT1-STAT2 heterodimer: experimental and theoretical studies" pps

... energy of interaction of -92.74, atomic contact energy of -11.21, attractive and repulsive van der Waals energy of -54.45 and 22.00, respectively, and energy of -4.24 derived from the formation of ... energy of -1.43, attractive and repulsive van der Waals energy of -68.32 and 34.70, respectively, and energy of -4.38 derived from the formation of hydrogen bonds In the interaction model of VWTSTATs ... http://www.virologyj.com/content/7/1/263 Page of 10 Figure Homologous modeling and differences of theoretical 3D structure of VWT and VGly (A) Models of V proteins, VWT and (B) VGly built with the PDB:...

Ngày tải lên: 12/08/2014, 01:22

10 311 0
Báo cáo y học: "Influence of enrollment sequence effect on observed outcomes in the ADDRESS and PROWESS studies of drotrecogin alfa (activated) in patients with severe sepsis" pptx

Báo cáo y học: "Influence of enrollment sequence effect on observed outcomes in the ADDRESS and PROWESS studies of drotrecogin alfa (activated) in patients with severe sepsis" pptx

... Eli Lilly and Company WLM, JJ, MDW, and Page 12 of 13 (page number not for citation purposes) DRN are employees and stockholders of Eli Lilly and Company Authors' contributions P-FL and EA participated ... conception and design of the study, in the development and conduct of analyses, and in the clinical trials and data collection WLM, JJ, and DRN participated in the conception and design of the study, ... data verification and documentation of protocol violations which will allow for re-education if the sites demonstrate inadequate understanding of the protocol Page 10 of 13 (page number not for...

Ngày tải lên: 13/08/2014, 11:22

13 341 0
Experimental realization and theoretical studies of novel all optical devices based on nano scale waveguides

Experimental realization and theoretical studies of novel all optical devices based on nano scale waveguides

... band is modeled by many pairs of levels, which can quite accurately take into account of band filling effect and interband and 26 intraband transition However, introducing sufficient number of ... supervisors, Prof Chong Tow Chong and Prof Ho Seng-Tiong, for their continuous support of my Ph D study and research I would especially like to thank Prof Ho, for the patient guidance, encouragement, and ... potential of electron and hole , : Fermi-Dirac distribution of electron and hole : Density of states : Dipole dephasing rate : spontaneous emission time , : Incident and transmitted intensity of control...

Ngày tải lên: 09/09/2015, 08:14

234 504 0
analytical and numerical studies of bose   einstein condensates

analytical and numerical studies of bose einstein condensates

... problem of insufficient conditions for the normalization of three wavefunctions Two inherent conditions of the system are the conservation of total particle number and the conservation of total ... temperature of the order of 100nK is required so that λdB is of the order of interatomic spacing At the same time, a gaseous state of the system has to be maintained to avoid collision of particles ... cooling stage is to trap the atoms with magnetic field The magnetic trap creates a thermally isolated and material-free wall that confines the atoms and at the same time prevents the nucleation of atomic...

Ngày tải lên: 10/09/2015, 15:51

166 460 0
Experimental and numerical investigation of novel pine oil biofuel in a diesel engine

Experimental and numerical investigation of novel pine oil biofuel in a diesel engine

... forms the profound advantage and distinction of the proposed fuel herein In addition to the evaluation of physical and thermal properties of pine oil, fundamental study on evaporation and spray ... diesel engine would prove costly and requires lot of efforts, given the diesel engine is standardized for the use of diesel only and any use of new fuel demands lot of engine modifications To confront ... air to ignite momentarily It is one of the important parameters in respect of fuel handling and storage, and is expected to be in compliance with insurance and fire regulation In general, these...

Ngày tải lên: 12/09/2015, 11:01

156 236 0
w