c 757 783 queen of the franks

Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt

Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt

... CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca 864 ♦ cagtcccctcaacactgcttccggccgaggaggagaccttcccccaccttccccggccccctgtcccagtgc 936 ccacacctgatgaccccactcctggctgtacccctctcccgctcagctcacccccccgcaggggctgctgac ... CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctggtcagcggaggagctggccccctc 864 Q Y V P Q G P ♦ (245) tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936 cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 1008 tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag ... 288 CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTGCTACAGCGTTAAGAACGGGGCGGACATCGCCCTG 360 CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCCGGTCACCCTGCCCCCTGAGTCGGAGACC 432 TTCCCCCCGGGGACGCAGTGCTGGGTGACGGGCTGGGGCAACGTGGACAATGGAAGGCGCCTGCCGCCCCCA...

Ngày tải lên: 17/03/2014, 09:20

11 527 0
Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

... ATTCCGGAACCAGGAGGAGCGC-3¢ was used in all cases, together with the reverse primer (a) 5¢-ATA GTTTAGCGGCCGCTTACTTGCGCTGGATGATGAG CAGG-3¢ for c1 –218, (b) 5¢-ATAGTTTAGCGGCCGC TTAGTGATGGTGATGGTGATGCTTGCGCTGGATG ... the forward primer 5¢-GGTGTAGAATTCAAGAACGAGGAACTGCG-3¢ was combined with (a) 5¢-ATAGTTTAGCGGCCG CTTACTTCCGGCGGATGATGAGCGAG-3¢ for e1–219, (b) 5¢-ATAGTTTAGCGGCCGCTTAGTGATGGTGATG GTGATGCTTCCGGCGGATGATGAGCGAG-3¢ ... GTGATGCTTCCGGCGGATGATGAGCGAG-3¢ for e1– 219HIS, (c) 5¢-ATAGTTTAGCGGCCGCTTACGGCTT CCGGCGGATGATGAGCGAG-3¢ for e1–220, or (d) 5¢ATAGTTTAGCGGCCGCTTAGTGATGGTGATGGTGA TGCGGCTTCCGGCG-GATGATGAGCGAG-3¢ for e1–...

Ngày tải lên: 30/03/2014, 10:20

12 394 0
Báo cáo khoa học: The soluble form of the membrane-bound transferrin homologue, melanotransferrin, inefficiently donates iron to cells via nonspecific internalization and degradation of the protein pdf

Báo cáo khoa học: The soluble form of the membrane-bound transferrin homologue, melanotransferrin, inefficiently donates iron to cells via nonspecific internalization and degradation of the protein pdf

... relevance to the clearance of sMTf from the circulation in conditions such as melanoma and Alzheimer’s disease [19,20] and the possible use of this molecule as a carrier for chemotherapeutic agents ... suggests increased efficacy of conjugates compared to free agents [49,50] It is possible that the use of the conjugate may enable the delivery of the agent to the lysosomal compartment that then results ... SK-N-MC neuroepithelioma cells, MRC-5 fibroblasts and MCF-7 breast cancer cells, were obtained from the American Type Culture Collection Mouse LMTK– fibroblasts were obtained from the European Collection...

Ngày tải lên: 31/03/2014, 09:20

11 373 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States _part1 docx

United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States _part1 docx

... Treasury; the Chairman of the Board of Governors of the Federal Reserve System; the Acting Comptroller of the Currency; and the Chairmen and Ranking Minority Members of the Senate Committee on ... Insurance Corporation; the Director of the Page GAOIAFMD-92-73 This is trial version www.adultpdf.com Bank Inrurance Fund h B.114881 Office of Management and Budget; the Secretary of the Treasury; the ... S our consideration of FDIC’ internal control structure and on its compliance with laws and regulations as they relate to the Fund We conducted our audits in accordance with generally accepted...

Ngày tải lên: 19/06/2014, 13:20

11 272 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States _part2 pot

United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States _part2 pot

... financial reporting, consisting of the policies and procedures related to the form, content, and preparation of the Fund’ financial statements s For each of the internal control structure categories ... number of additional concerns The Inspector General’ audit, which was also s conducted at four FDIC consolidated receivership offices, found that high error rates in LAMIS files compromised the accuracy ... transactions are executed in accordance with management’ s authorization and recorded properly to permit the preparation of financial statements in accordance with generally accepted accounting...

Ngày tải lên: 19/06/2014, 13:20

11 276 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States _part3 potx

United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States _part3 potx

... uncertaintiesbecause of changing economic condltlons affecting real estate assets now In the marketplace These factors could reduce the BIF’ actual recovarlas upon the sale of these assets from the level of recoveries ... amortized cost, which is the purchase price of securities less the amortized premium or plus the accreted discount Such amortlzatlone and accretlons are computed on a daily basls from the date of acquisltlon ... settlement on the sale to Citicorp of the Delaware Brfdge Sank (the credft card subsidlary of Flrst RepublIcBankof Texas) Those funds were released In July of 1991 Cash and cash equivalentsas of December31...

Ngày tải lên: 19/06/2014, 13:20

11 304 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States _part4 doc

United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States _part4 doc

... pooi, the FDIC pays the assuming bank the aggregate of net losses over net geinr lf any In eddltlon to the rbcwe coete for which the receiver has a claim against the assets of the receIvership ,the ... asset putbacks the tctal volume d a88ets for which the FDIC remains at risk and the estimated cost of these tmnaactkwrs,whkh Include8 credit losaea carrylng cost8 and admlnlstmtlve and lncentlve ... The FDIC relied on this flndlng regarding aofvencyaa the determlnlngfactor In deflnlng the existence of the “accountable event’that triggers loaa recognition under generally accepted accounting...

Ngày tải lên: 19/06/2014, 13:20

11 303 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part1 potx

United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part1 potx

... Acting Chairman of the Board of Directors of the Federal Deposit Insurance Corporation; the Chairman of the Board of Governors of the Federal Reserve System; the Comptroller of the Currency; the Acting ... permit the preparation of financial statements in accordance with generally accepted accounting principles, and (3) transactions of BIF, SAIF, and FRF were executed in accordance with significant ... and the results of its operations and its cash flows for the years then ended, in conformity with generally accepted accounting principles The financial statements and accompanying notes of the...

Ngày tải lên: 19/06/2014, 13:20

13 273 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part2 potx

United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part2 potx

... procedures for processing and reconciling cash receipts at its consolidated receivership offices Because FDIC is in the process of merging certain consolidated receivership offices as part of ... recovery rates contained in FDIc’ Credit Manual s ‘“A4justed pool balance represents the principal balance of the asset, net of specific reserves, as reflected on the accounting records of the relevant ... strategies, certain FDIC and servicers’ account officers applied across -the- board discounts to appraised values in estimating recoveries, while other account officers estimated recoveries at 100 percent...

Ngày tải lên: 19/06/2014, 13:20

13 266 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part3 pot

United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part3 pot

... FDIC’S oversight personneI to verify the accuracy of the activity and balances on these systems; and require the servicer to reconcile checks received to checks deposited each day, and reconcile ... document the accuracy and completeness of the balances and activity reported to FLHC contracted asset servicers back to the servicers’ detail by records This is trial version www.adultpdf.com Page ... of the Federal Deposit Insurance Corporation direct the heads of the Division of Depositor and Asset Services and the Division of Finance to + promptly reconcile servicer asset bahrnces each...

Ngày tải lên: 19/06/2014, 13:20

13 239 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part4 doc

United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part4 doc

... remain subject to uncertainties because of changing economic conditions These factors could reduce the claimants’ actual recoveries upon the sale of these assetsfrom the level of recoveries currently ... and certain qualifying expenses These arrangements typic-ally direct that the receiver pay to the acquirer a specified percentage of the losses triggered by the charge-off of assets covered by the ... with any of its estimated losses, the FDIC cannot predict the timing of events with reasonable accuracy These liabilities and a corresponding reduction in the Fund Balance are recognized in the period...

Ngày tải lên: 19/06/2014, 13:20

13 342 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part5 pdf

United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part5 pdf

... future cash tlows because the FDlC cannot predict the timing of events with reasonable accuracy For this reason, the FDIC considers the total estimate of these losses to be the best measure of their ... 12,153 2c! u& 282,382 $282,382 (1) Consists of one-day special Treasury Certificates For 1992, the accumulated liability is presented in the Statementsof Financial Position - “Accounts payable, accrued ... significantly increase the cost of bank resolutions to the FDIC Further, comparisons with other financial instruments not provide a reliable measure of their fair value Due to these and other factors,...

Ngày tải lên: 19/06/2014, 13:20

13 282 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part6 pot

United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part6 pot

... directly charged to each Fund under the FDIC’ management are allocated on the basis of the relative degree s to which the operating expenses were incurred by the Funds The FDIC includes the cost ... recognition under generally accepted accounting principles As with any of its estimated losses, the FDIC cannot predict the timing of events with reasonable accuracy These liabilities and a corresponding ... 1993, the receiver owea the FRF $175 million The SAIF accounts currently reflect $932 thousand held in escrow on behalf of the receivership As of December 31, 1993, the SAfF, in its receivership capacity,...

Ngày tải lên: 19/06/2014, 13:20

13 242 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part7 ppt

United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part7 ppt

... cash flows becausetbe FDIC cannot predict the timing of events with reasonable accuracy For this reason, the FDIC considers the total estimate of these losses to be the best measure of their fair ... significant effect on the amount of the obligation and periodic cost reported If the health care cost rate were increased one percent, the accumulated postretirement benefit obligation as of December ... significandy increase the cost of bank resolutions to the FDIC Further, comparisons with other financial instruments not provide a reliable measure of their fair value Due to these and other factors,...

Ngày tải lên: 19/06/2014, 13:20

13 283 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part8 ppt

United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part8 ppt

... in the marketplace These factors could reduce the FRF’ actual recoveries upon the sale of s these assetsfrom the level of recoveries currently estimated Receivables from operating thriAs include ... are allocated an the basis of the relative degree s to which the operating expenses were incurred by the Funds+ The FDIC includes the cost of facilities used in operations in the BIF’ financial ... Terms and Conditions’ gave the FDIC, as manager of the FRF, authority to take such action as might be necessaryto effect the acquisition of Heartland The FDlC determined that the value of the FRF’...

Ngày tải lên: 19/06/2014, 13:20

13 254 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part9 potx

United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part9 potx

... discount rate and health care cost rate have a significant effect on the amount of the obligation and periodic cost reported If the health care cost rate were increased one percent, the accumulated ... transactions to permit the preparation of financial statements in accordance with generally accepted accountig principles These included relevant internal controls over the following significant cycles, ... Tested compliance with significant provisions of the Federal Deposit Insurance Act, as amended; the Chief Financial Officers Act; and the Federal Home Loan Bank Act, as amended The provisions selected...

Ngày tải lên: 19/06/2014, 13:20

13 291 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part10 pot

United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States_part10 pot

... the accuracy of the asset pool activity and balances, system and converting the servicer's accounting to the receivership basis of accounting, and record8 strengthening the cash receipt8 procedure8 ... completeness of that FDIC verify and documm t the accuracy reported to FDIC by contracted asset the balances and activity servicers, back to the servicers' detail records FDIC RESPONSE: of Finance (DOF) ... contractor's accounting and financial records for accuracy and completeness DOF coordinates with DA.5 to resolve issues affecting the accuracy of the financial information Both divisions jointly participate...

Ngày tải lên: 19/06/2014, 13:20

7 251 0
The Deeds of God through the Franks Copyright (C)1997 pot

The Deeds of God through the Franks Copyright (C)1997 pot

... Jerusalem, or the Eastern church, as it was then In the time of the faithful Helen, the mother of the ruler Constantine, throughout the regions known for the traces of the Lord's sufferings, churches ... gates of the city, at the entrances of churches and temples, they must pay ransoms Each time they move from one place to another they are faced with another charge, compelled to pay ransom, and the ... in the Gesta Francorum) differs significantly and with clear polemical intentions from the scene in Fulcher; Guibert attributes the skepticism about the authenticity of the Lance to the death of...

Ngày tải lên: 17/03/2014, 20:20

116 438 0
w