building a column from an expression

Modeling in MathWorks Simscape  by building a model of an automatic  gearbox

Modeling in MathWorks Simscape by building a model of an automatic gearbox

... Physical Domain Across Variable Through Variable Electrical Hydraulic Magnetic Mechanical rotational Mechanical translational Pneumatic Thermal Voltage Pressure Magnetomotive force (mmf) Angular ... equation for planetary gear train can be written as: (1.25) And when the planetary gear is moving along a solid axle the angular speed is the same ( and ) The equation above can now be written as: ... be applied to other physical domains and with this came the rise of languages such as Simscape, Modelica, MapleSim and 20Sim The advantages of these tools are particularly that the mathematical...

Ngày tải lên: 24/07/2014, 09:44

63 470 0
Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

... E.P., Martin-Eauclaire, M.F., Mansuelle, P & Sampieri, F (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the alpha- and beta-sites of the mammalian ... primers A3 were as follows: 5¢-GCCGGATCCCCGATGACGATGACAAG GATGGATATATAAGA-3¢ as forward primer containing a BamHI restriction enzyme site (underlined) and corresponding to five codons encoding an enterokinase ... they are equally potent for cardiac and neuronal Na+ channels [39] Pharmacological activity of recombinant BmKIM Injected into larvae, rBmKIM caused a slow, progressive depressant flaccid paralysis...

Ngày tải lên: 31/03/2014, 09:20

8 474 0
Báo cáo y học: " A method to estimate the efficiency of gene expression from an integrated retroviral vector" potx

Báo cáo y học: " A method to estimate the efficiency of gene expression from an integrated retroviral vector" potx

... signal arising from the incoming virus and from passively transduced GFP can be considerable [13] In addition these signals can arise from the expression from unintegrated species The latter can ... excluded by using a selectable marker To survive and proliferate in an antibiotic, a cell must express the appropriate antibiotic resistance gene, and pass the selectable marker onto daughter cells ... of Taq DNA polymerase (Sigma) and an appropriate amount of DNA template In PCR for LTR, 5% DMSO http://www.retrovirology.com/content/3/1/51 (Sigma) was used as an enhancer The reaction was made...

Ngày tải lên: 13/08/2014, 09:20

10 279 0
a study on mataphorical expressions in english advertising slogans from the semantic approach = nghiên cứu các biểu thức ẩn dụ sử dụng trong các khẩu hiệu quảng cáo bằng tiếng anh từ phương diện ngữ dụng học

a study on mataphorical expressions in english advertising slogans from the semantic approach = nghiên cứu các biểu thức ẩn dụ sử dụng trong các khẩu hiệu quảng cáo bằng tiếng anh từ phương diện ngữ dụng học

... the analysis is (i) a semantic analysis which bases itself on a semantic approach and Lakeoff and Johnson‟s theory of metaphors and (ii) a hypothesis-testing analysis on each type of metaphors ... to reach where they are today Among the four major components a brand needs in advertising campaigns-brand name, logo, slogans and theme song, slogan is regarded as a determinant for a brand‟s ... emotion as advertisers often to create “affective meanings” rather than the ambiguity or meaninglessness 14 CHAPTER II AN ANALYSIS ON METAPHOR EXPLOITATION IN ADVERTISING SLOGANS Advertising slogan:...

Ngày tải lên: 02/03/2015, 14:22

48 853 1
Báo cáo y học: "Do we need a critical care ultrasound certification program? Implications from an Australian medical-legal perspective"

Báo cáo y học: "Do we need a critical care ultrasound certification program? Implications from an Australian medical-legal perspective"

... reasonable skill and care - a standard reasonably expected of a practitioner with an equivalent level of training and experience [9] A practitioner is expected to have the relevant qualifications and ... in managing the patient ‘Ultrasound, biopsy and referral were all available as reasonable options in the circumstances It was a breach of duty in the circumstances not to utilize the available ... themselves out as having special skills, may be required to meet the standard of a doctor with those special skills or a higher standard than the ordinary Huang and McLean Critical Care 2010, 14:313...

Ngày tải lên: 25/10/2012, 10:02

6 715 0
Tài liệu Pass a Dataset Back from an XML Web Service docx

Tài liệu Pass a Dataset Back from an XML Web Service docx

... delete columns from a data table If the goal is to include all the columns in the table and accept the Password column, then when other columns are added, you will not have to touch the code because ... - - - ... Login windows Form Create a new Windows Form and place the controls shown in Table 13.2 in the order displayed in Figure 13.14 Table 13.2 Label, TextBox, DataGrid, and Command Button Control Property...

Ngày tải lên: 24/12/2013, 06:17

4 284 0
Tài liệu Building a RISC System in an FPGA ppt

Tài liệu Building a RISC System in an FPGA ppt

... OPERAND SELECTION With the two source registers AREG and BREG in hand, you now select the A and B operands, and latch them in the A and B registers Some examples are shown in Table The A operand ... r%0,%1\nbeq %a\ n” uses a cmpi, beq sequence to compare a register to a constant and branch to this label if equal I removed any remaining 32-bit assumptions inherited from mips.md, and arranged to ... requirements, and running the 3-state bus horizontally over the columns), iterative design (measuring the area and delay effects of each potential feature), and using timing-driven place-and-route and...

Ngày tải lên: 26/01/2014, 14:20

7 401 3
Tài liệu Building a RISC System in an FPGA Part 2 docx

Tài liệu Building a RISC System in an FPGA Part 2 docx

... specifications, source code, schematics, and links to related sites REFERENCE [1] D Patterson and J Hennessy, Computer Organization and Design: The Hardware/Software Interface, Morgan Kaufmann, San ... PC0 += 2×disp8 BRANCH SELPC PCCE It indicates that all pipe stages are ready and the pipeline can advance IF jal call AN ← PC0 = SUM PCCE PCE is asserted when RDY signals IFreset AN ← PC0 = SELPC ... can fetch either an instruction (AN ← PC0 += 2) or a DMA word (AN ← PC1 += 2) per memory cycle After an instruction is fetched, if DCANNUL FDPE DCAN BRANCH PCE JUMP RESET PRE Q CE DCANNUL BRANCH...

Ngày tải lên: 26/01/2014, 14:20

7 390 2
Tài liệu Building a RISC System in an FPGA Part 3 doc

Tài liệu Building a RISC System in an FPGA Part 3 doc

... CELLAR® assert XA14:1, data LSB, XA0=1 assert /WE deassert /WE, hold XA and data assert data MSB, XA1=0 assert /WE deassert /WE, hold XA and data RAM read byte RAM read word RAM write byte RAM ... make ease-of-use tradeoffs in favor of core users Because FPGAs are malleable and FPGA SoC design is so new, I wanted an interface that can evolve to address new requirements without invalidating ... registers are memory mapped (see Table 1) There are eight transaction types: (external RAM or I/O) × (read or write) × (byte or word), all decoded from AN1 5:0, WORDN, and READN MEMCTRL manages transfers...

Ngày tải lên: 26/01/2014, 14:20

7 472 2
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

... pIM3982 and transformants were analyzed for b-1,4-endogalactanase production using azo-galactan Transformant NW290::pIM3982.77 was selected as the highest b-1,4-endogalactanase producing transformant ... in Materials and methods Purification and characterization of GALA Hydrolysis of arabinogalactans To obtain an A niger transformant that produces increased levels of b-1,4-endogalactanase, a construct ... whether a small amount of a- L-1,3-arabinofuranosidase was responsible for the disappearance of Fig HPAEC analysis of the hydrolysis of arabinogalactans by GALA Three different arabinogalactans were...

Ngày tải lên: 21/02/2014, 01:21

9 669 0
Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx

Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx

... strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢ Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢ Sense strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢ Anti-sense strand ... 5¢-GTACAGGGTTGAACCATGCGCTATGTCAAAATCAATACC-3¢ Sense strand 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3¢ Anti-sense strand 5¢-CAGGGTTGAACCATGCGCTATGGCAAAATCAATACCATC-3¢ Sense strand 5¢-TATGTATGGGTTCAATTCTTTAACAATCCACCATGCCAG-3¢ ... Glu127Ala Asp125Ala/Glu127Ala Tyr183Phe Asp125Ala/Tyr183Phe Asp125Ala/Glu127Ala/ Tyr183Phe Sense strand 5¢-GATGGTATTGATTTTGCCATAGAGCATGGTTCA-3¢ Anti-sense strand 5¢-TGAACCATGCTCTATGGCAAAATCAATACCATC-3¢...

Ngày tải lên: 22/02/2014, 04:20

9 616 0
Báo cáo Y học: Expression and characterization of recombinant vitamin K-dependent c-glutamyl carboxylase from an invertebrate, Conus textile doc

Báo cáo Y học: Expression and characterization of recombinant vitamin K-dependent c-glutamyl carboxylase from an invertebrate, Conus textile doc

... ng; lane 4, 20 ng) were applied and used as a standard The amount of protein in lanes 5–8 in (A) (lane 5, ng; lane 6, ng; lane 7, ng; lane 8, 16 ng) and (B) (lane 5, 10 ng; lane 6, 20 ng; lane ... B.M (2002) Gamma-glutamyl carboxylation: an extracellular posttranslational modification that antedates the divergence of molluscs, arthropods, and chordates Proc Natl Acad Sci USA 99, 1264–1269 ... that enhances carboxylase activity are the same or distinct Analysis of enzymatic properties of the Conus carboxylation system, which has many functional similarities to the mammalian carboxylation...

Ngày tải lên: 17/03/2014, 10:20

11 537 0
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

... Tanaka H, Yamamoto T, Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aeruginosa elastase II Kinetic analysis and identification ... Pa3 Pa4 Pa5 Pa6 Pa7 Pa8 Pa9 Pa10 Pa11 Pa12 Ac-EVYLVE-NH2 Ac-EVYLLE-NH2 Ac-EVYLAE-NH2 Ac-EVYAVE-NH2 Ac-EVYALE-NH2 Ac-EVYAAE-NH2 Ac-ELYLVE-NH2 Ac-ELYAVE-NH2 Ac-ELYLLE-NH2 Ac-ELYLAE-NH2 Ac-ELYALE-NH2 ... internal standard, because it was not hydrolysed by PrtA Peak areas were normalized with the internal standard, and the degree of cleavage was calculated from the reduction in the normalized area...

Ngày tải lên: 23/03/2014, 09:20

11 425 0
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc

Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc

... Coordinator Vishal Bodwani Proofreader Aaron Nash Kishore Shenoi Pankaj Ghanshani Indexer Tejal Daruwale Acquisition Editors Amey Kanse Kartikey Pandey Lead Technical Editor Kartikey Pandey Technical ... we mean by management? [8] Chapter The classical definition of management, as also found on Wikipedia, is as follows: Management in all business areas and organizational activities are the acts ... • Larger policy changes • Larger organizational changes, like re-orgs and mergers • Managing negative circumstances like backlash from dissatisfied customers Indian managers also get to play...

Ngày tải lên: 23/03/2014, 13:20

328 4,5K 0
Báo cáo "A process of building 3D models from images " pptx

Báo cáo "A process of building 3D models from images " pptx

... is an effective way to compute X Fortunately, between (P, P’) and fundamental matrix has a great constraint [2] we can easily compute one from other and in turn We can have unique F matrix from ... Segment Assimilating Nucleus) area is defined as an area including interested pixels which have the same brightness as nucleus’s brightness The shape of USAN areas conveys important information about ... Polar rectification Figure A process of 3D reconstruction 3.1 SUSAN corner extraction Feature can be classified as feature area, feature line or feature point SUSAN (Smallest Univalue Segment Assimilating...

Ngày tải lên: 28/03/2014, 13:20

6 318 0
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

... construction of the poneratoxin gene [11] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were used ... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ were ... signal peptide sequence: 5¢-GAATTCATGCTACTAGTAAAT CAG-3¢ (number 1) and downstream primer with a sequence complementary to the 5¢ end of poneratoxin gene and 3¢ end of a signal peptide: 5¢-CAGAAGCGGAA...

Ngày tải lên: 30/03/2014, 13:20

10 696 0
Báo cáo khoa học: "An efficient algorithm for building a distributional thesaurus (and other Sketch Engine developments)" pdf

Báo cáo khoa học: "An efficient algorithm for building a distributional thesaurus (and other Sketch Engine developments)" pdf

... distributions and lexical semantics Computers in the Humanities, 30:281–291 Dekang Lin 1998 Automatic retrieval and clustering of similar words In COLING-ACL, pages 768–774 Deepak Ravichandran, Patrick Pantel, ... result either on raw frequency or on ARF Walter Daelemans, Antal van den Bosch, and Jakub Zavrel 1999 Forgetting exceptions is harmful in language learning Machine Learning, 34(1-3) Acknowledgements ... Empirical estimates of adaptation: The chance of two noriegas is closer to p/2 than p2 In COLING, pages 180–186 Text type, subcorpora and keywords James Curran 2004 From Distributional to Semantic...

Ngày tải lên: 31/03/2014, 01:20

4 346 0
Báo cáo Y học: A neuropeptide Y receptor Y1-subfamily gene from an agnathan, the European river lamprey doc

Báo cáo Y học: A neuropeptide Y receptor Y1-subfamily gene from an agnathan, the European river lamprey doc

... using a linear gradient Absorbance was measured at 214 and 280 nm and the major peak in the chromatogram was collected by hand The identity of the peptides was confirmed by automated Edman degradation ... putative transmembrane regions, a cysteine pair linking extracellular loop and loop 2, and a cysteine in the C-terminal tail where palmitoylation could serve as an anchor to the membrane and ... detected transcripts in CNS, liver and gonads as well as in larval tissue, but not in muscle tissue (Fig 4A) Total RNA from a shark, Squalus acanthias, liver was run in parallel as a negative control...

Ngày tải lên: 31/03/2014, 23:20

9 290 0
báo cáo sinh học:" How labour intensive is a doctor-based delivery model for antiretroviral treatment (ART)? Evidence from an observational study in Siem Reap, Cambodia" potx

báo cáo sinh học:" How labour intensive is a doctor-based delivery model for antiretroviral treatment (ART)? Evidence from an observational study in Siem Reap, Cambodia" potx

... collection, analysed the data, and wrote successive drafts of the manuscript Katharina Kober participated in the design of the study, participated in data collection and data analysis, and reviewed ... of care, but also at the level of care teams, health care facilities, and support systems These different layers of learning and adaptation can potentially have a multiplication effect, and may ... D, Hildebrand K, Boulle A, Maartens G, Louis F, Labatala V, Reuter H, Ntwana N, Goemaere E: Outcomes after two years of providing antiretroviral treatment in Khayelitsha, South Africa AIDS 2004,...

Ngày tải lên: 18/06/2014, 17:20

9 451 0
báo cáo hóa học: " The agreement between workers and within workers in regard to occupational exposure to mercury in dental practice assessed from a questionnaire and an interview" potx

báo cáo hóa học: " The agreement between workers and within workers in regard to occupational exposure to mercury in dental practice assessed from a questionnaire and an interview" potx

... copper amalgam? In what year did all your use of copper amalgam end* Have you worked with amalgam that was manually mixed in a mortar? yes-no Have you ever manually weighted mercury and alloy and ... Chicago, IL, USA) The concordance between participants who had worked in the same clinic regarding the years the participants started and ended the use of copper amalgam and Dentomat was analyzed ... was deemed to be in accord with the Helsinki declaration on medical research ethics Statistical analysis Data were registered and analyzed with the data program Statistical Package for Social...

Ngày tải lên: 20/06/2014, 00:20

8 422 0
w