bao cao vitamin a

BÀI BÁO CÁO VITAMIN A

BÀI BÁO CÁO VITAMIN A

... vitamin A retinol () máu thấp vitamin A, gợi ý đồng-thiếu chế độ ăn uống gây lỗi giao thông vitamin A từ gan vào máu Vitamin K Dư th a vitamin A can thiệp vào hấp thu vitamin K, vitamin tan chất ... ch a vitamin số tiền đủ Vitamin A bổ sung: Nó bao gồm việc uống liều cao Vitamin A giọt xi-rô trẻ em từ tháng đến năm, hàng năm hai lần 10  Việc thiếu hụt Vitamin A: Một biểu thị thiếu hụt vitamin ... vitamin; lipit làm tăng hấp thụ tiền vitamin. [4] Chất môi trường h a học retinol beta-caroten, h a tan dầu beta-caroten, thức ăn thông thường alpha-caroten, thức ăn thông thường beta-cryptoxanthin,...

Ngày tải lên: 21/07/2015, 15:53

16 2,2K 6
Báo cáo y học: "Trace Elements, Heavy Metals and Vitamin Levels in Patients with Coronary Artery Diseas"

Báo cáo y học: "Trace Elements, Heavy Metals and Vitamin Levels in Patients with Coronary Artery Diseas"

... D Anti-oxidant vitamins and coronary heart disease N Engl J Med 1993; 328: 1487–1489 Marchioli R Antioxidant vitamins and prevention of cardiovascular disease: laboratory, epidemiological and ... the LDL particle Vitamin E plays an essential protective role against free radical damage (5) Previous experimental and epidemiologic evidence suggested that some antioxidant vitamins appear to ... clinical trial data Pharmacol Res 1999; 40: 227-238 Adams AK, Wermuth EO, Mcbride PE Antioxidant vitamins and the prevention of coronary heart disease Am Fam Physician 1999; 60: 895-904 Yavuz...

Ngày tải lên: 25/10/2012, 10:51

5 527 0
Báo cáo y học: "Effect of 1,25-dihydroxy-vitamin D3 in experimental sepss"

Báo cáo y học: "Effect of 1,25-dihydroxy-vitamin D3 in experimental sepss"

... for measurement of coagulation parameters were sampled directly in a citrate dilution (9:1) to avoid early coagulation Data were analyzed using non-parametric analysis of variance All data are ... did not reach statistical significance due to high variance of data Plasma ALT levels increased among both sham operated and CLP operated rats The ALT elevation was only significant among the ... experimental inflammatory bowel disease [3] Arteriolar and myocardial walls contain specific vitamin D receptors, and vitamin D exerts a direct effect on the vasculature causing an enhanced effect...

Ngày tải lên: 26/10/2012, 09:57

6 507 1
(kèm ppt báo cáo) Sự hấp thu vitamin

(kèm ppt báo cáo) Sự hấp thu vitamin

... ) Th a Vitamin C Vitamin C tích luỹ dùng liều cao lâu ngày, tạo sỏi oxalat sỏi thận urat, có hai loại sỏi gây ra:rối loạn tiêu h a; giảm độ bền hồng cầu Dùng vitamin C liều cao kéo dài thai phụ ... Vitamin C có nhiều loại rau tươi nước cam, chanh, quít, có hàm lượng cao rau xanh, đặc biệt cải xanh, tiêu, khoai tây, cải brussel,rau cải, cà chua, quýt, chanh, bưởi … 2.Phân bố Thành phần Vitamin ... đến Vitamin C 1.Cấu tạo Vitamin C (acid ascorbic) OH HO HO O O OH Vitamin C tồn thiên nhiên dạng phổ biến là: acid ascorbic, acid dehydroascorbic dạng liên kết ascorbigen 2.Phân bố Nguồn gốc: Vitamin...

Ngày tải lên: 30/10/2012, 09:45

21 794 3
Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx

Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx

... Proc Natl Acad Sci USA 100, 14754–14759 Slominski A, Zjawiony J, Wortsman J, Semak I, Stewart J, Pisarchik A, Sweatman T, Marcos J, Dunbar C & Tuckey RC (2004) A novel pathway for sequential transformation ... water, at a flow rate of 0.5 mLÆmin)1 Products were detected with a UV monitor at 265 nm Large-scale preparation of vitamin D3 metabolites for NMR 20-Hydroxyvitamin D3 was prepared enzymatically ... with vitamin D3 1 7a, 20-Dihydroxyvitamin D3 and 1 7a, 20,23-trihydroxyvitamin D3 also dissociate from the P450scc in Fig Pathways for the metabolism of vitamin D3 by P450scc The major pathway is...

Ngày tải lên: 18/02/2014, 17:20

12 705 0
Tài liệu Báo cáo khoa học: Gas6 and protein S Vitamin K-dependent ligands for the Axl receptor tyrosine kinase subfamily pptx

Tài liệu Báo cáo khoa học: Gas6 and protein S Vitamin K-dependent ligands for the Axl receptor tyrosine kinase subfamily pptx

... regulator of blood coagulation, acting as a cofactor for activated protein C in the degradation of clotting factors Va and VIIIa [5] Gas6 has the same domain organization as protein S, namely an ... 6872–6880 106 Tanaka K, Nagayama Y, Nakano T, Takamura N, Namba H, Fukada S, Kuma K, Yamashita S & Niwa M (1998) Expression profile of receptor-type protein tyrosine kinase genes in the human thyroid ... L1273–L1281 Nakamura YS, Hakeda Y, Takakura N, Kameda T, Hamaguchi I, Miyamoto T, Kakudo S, Nakano T, Kumegawa M & Suda T (1998) Tyro receptor tyrosine kinase and its ligand, Gas6, stimulate the function...

Ngày tải lên: 19/02/2014, 05:20

14 602 0
Tài liệu Báo cáo khoa học: Glucuronate, the precursor of vitamin C, is directly formed from UDP-glucuronate in liver pptx

Tài liệu Báo cáo khoa học: Glucuronate, the precursor of vitamin C, is directly formed from UDP-glucuronate in liver pptx

... spectrophotometric glucuronate assay Glucuronate was assayed enzymatically with E coli uronate isomerase and mannonate dehydrogenase [38] This method was also used to assay glucuronate 1-phosphate and b-glucuronides, ... 5521–5525 Yamashita A, Nagatsuka T, Watanabe M, Kondo H, Sugiura T & Waku K (1997) Inhibition of UDP-glucuronosyltransferase activity by fatty acyl-CoA Kinetic studies and structure-activity relationship ... ATP-Mg was antagonized by metyrapone, aminopyrine and chloretone (Fig 7B,C) Further characterization of the cofactor indicated that it was retained on charcoal (Fig 7A) and on the anion-exchanger...

Ngày tải lên: 19/02/2014, 07:20

12 659 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower eukaryotes ... Saccharomyces cerevisiae D-arabinono-1,4-lactone oxidase (ALO), P54783; Candida albicans D-arabinono-1,4-lactone oxidase (ALO), O93852; Neurospora crassa, Q7SGY1; Gibberella zeae, XP_388870; Arabidopsis...

Ngày tải lên: 07/03/2014, 12:20

11 571 0
Báo cáo khoa học: The cytochrome P450scc system opens an alternate pathway of vitamin D3 metabolism docx

Báo cáo khoa học: The cytochrome P450scc system opens an alternate pathway of vitamin D3 metabolism docx

... Chem 32, 810–812 22 Sakaki T, Sawada N, Komai K, Shiozawa S, Yamada S, Yamamoto K, Ohyama Y & Inouye K (2000) Dual metabolic pathway of 25-hydroxyvitamin D3 catalyzed by human CYP24 Eur J Biochem ... Sakaki T, Hatakeyama S, Hanada M, Abe D, Kamao M, Okano T, Ohta M & Inouye K (2004) Novel metabolism of alpha,25dihydroxyvitamin D3 with C24–C25 bond cleavage catalyzed by human Cyp2 4a1 Biochemistry ... 3007–3018 14 Kamao M, Tatematsu S, Hatakeyama S, Sakaki T, Sawada N, Inouye K, Ozono K, Kubodera N, Reddy GS & Okano T (2004) C-3 epimerization of vitamin D3 metabolites and further metabolism of...

Ngày tải lên: 07/03/2014, 21:20

11 401 0
Báo cáo khoa học: In vivo studies of altered expression patterns of p53 and proliferative control genes in chronic vitamin A deficiency and hypervitaminosis pot

Báo cáo khoa học: In vivo studies of altered expression patterns of p53 and proliferative control genes in chronic vitamin A deficiency and hypervitaminosis pot

... primers (5¢-TGAGTGCA AGCGGTGTCTTA-3¢ (forward) and 5¢-TAGTGGTGA TGTGCCCATG-3¢ (reverse); primers for p21WAF1/CIF1: 5¢-ACAGCGATATCGAGACACTCA-3¢ (forward) and 5¢-GTGAGACACCAGAGTGCAAGA-3¢ (reverse); ... primers for p53: 5¢-CACAGTCGGATATGAGCATC-3¢ (forward) and 5¢-GTCGTCCAGATACTCAGCAT-3¢ (reverse) and primers for cyclin D1: 5¢-TGTTCGTGGC CTCTAAGATGA-3¢ (forward) and 5¢-GCTTGACTCCA GAAGGGCTT-3¢ (reverse); ... acid receptor induced by the treatment, as RAR expression was similar in control, vitamin A- deficiency and hypervitaminosis (Fig 5) rats An antibody against a protein unrelated to vitamin A was...

Ngày tải lên: 08/03/2014, 08:20

9 509 0
Báo cáo khoa học: Three-step hydroxylation of vitamin D3 by a genetically engineered CYP105A1 doc

Báo cáo khoa học: Three-step hydroxylation of vitamin D3 by a genetically engineered CYP105A1 doc

... fragment containing R73V ⁄ R8 4A and FDX1 genes, with HindIII and PstI restriction sites, was prepared using the primers 5¢-ACCAAGCTTATGAAAAGATACCGCCACGACG-3¢ and 5¢-TTCTGCAGTCACCAGGTGACCGGGAGTTCG-3¢, ... 2138–2141 Ishizuka S, Sumitani K, Hiura K, Kawata T, Okawa M, Hakeda Y & Kumegawa M (1990) Biological activity assessment of alpha,25-dihydroxyvitamin D3-26,23-lactone and its intermediate metabolites ... in vitamin D signal transduction Curr Drug Targets Immune Endocr Metabol Disord 3, 43–66 Sasaki J, Miyazaki A, Saito M, Adachi T, Mizoue K, Hanada K & Omura S (1992) Transformation of vitamin...

Ngày tải lên: 15/03/2014, 23:20

11 505 0
Báo cáo khoa học: Vitamin C Biosynthesis, recycling and degradation in mammals doc

Báo cáo khoa học: Vitamin C Biosynthesis, recycling and degradation in mammals doc

... beta-keto-l-gulonic acid Biochim Biophys Acta 52, 170175 Nakagawa J, Ishikura S, Asami J, Isaji T, Usami N, Hara A, Sakurai T, Tsuritani K, Oda K, Takahashi M et al (2002) Molecular characterization of mammalian ... Vitamin C metabolism and recycling in mammals C L Linster and E Van Schaftingen Vitamin C (or l-ascorbic acid; hereafter, ascorbic acid and ascorbate will always refer to l-ascorbic acid and ... EM, Board PG, Whitbread AK, Tetlow N, Cavanaugh JA, Blackburn AC & Masoumi A (2005) Characterization of the monomethylarsonate reductase and dehydroascorbate reductase activities of Omega class...

Ngày tải lên: 16/03/2014, 12:20

22 445 0
Báo cáo Y học: Expression and characterization of recombinant vitamin K-dependent c-glutamyl carboxylase from an invertebrate, Conus textile doc

Báo cáo Y học: Expression and characterization of recombinant vitamin K-dependent c-glutamyl carboxylase from an invertebrate, Conus textile doc

... Letsou, A. , Olivera, B.M & Bandyopadhyay, P.K (2001) On a potential global role for vitamin K-dependent gamma-carboxylation in animal systems Evidence for a gamma-glutamyl carboxylase in Drosophila ... C-terminal extension relative to the mammalian carboxylases The Conus carboxylase has 811 amino acids compared with 758 amino acids for most of the mammalian carboxylases The large central portion ... B.M (2002) Gamma-glutamyl carboxylation: an extracellular posttranslational modification that antedates the divergence of molluscs, arthropods, and chordates Proc Natl Acad Sci USA 99, 1264–1269...

Ngày tải lên: 17/03/2014, 10:20

11 537 0
BÁO CÁO " NGHIÊN CỨU SỰ BIẾN ĐỔI HÀM LƯỢNG VITAMIN C, POLYPHENOL VÀ HOẠT TÍNH KHÁNG OXI HOÁ CỦA QUẢ ỔI TRONG QUÁ TRÌNH CHÍN " potx

BÁO CÁO " NGHIÊN CỨU SỰ BIẾN ĐỔI HÀM LƯỢNG VITAMIN C, POLYPHENOL VÀ HOẠT TÍNH KHÁNG OXI HOÁ CỦA QUẢ ỔI TRONG QUÁ TRÌNH CHÍN " potx

... 9:184-8 Sancho L., E Yahia, G González-Aguilar (2010) Identification and quantification of phenols, carotenoids, and vitamin C from papaya (Carica papaya L., cv Maradol) fruit determined by HPLC-DAD-MS/MS-ESI ... estimating antioxidant activity from guava fruit extracts Journal of Food Composition and Analysis 19, 669-675 Yusof S., M Suhaila (1987) Physicochemical changes in guava during development and maturation ... Nguyễn Hương Thủy TÀI LIỆU THAM KHẢO Alothman M., Rajeev Bhat, A A Karim (2009) Antioxidant capacity and phenolic content of selected tropical fruits from Malaysia, extracted with different solvents...

Ngày tải lên: 19/03/2014, 16:20

7 1,1K 5
Báo cáo khoa học: Vitamin D stimulates apoptosis in gastric cancer cells in synergy with trichostatin A ⁄sodium butyrate-induced and 5-aza-2¢-deoxycytidine-induced PTEN upregulation ppt

Báo cáo khoa học: Vitamin D stimulates apoptosis in gastric cancer cells in synergy with trichostatin A ⁄sodium butyrate-induced and 5-aza-2¢-deoxycytidine-induced PTEN upregulation ppt

... are shown as means ± standard deviations RNA isolation and quantitative real-time PCR Total RNA was extracted following the TaKaRa RNAiso Reagent manual, and reverse transcribed into cDNA using ... potential application of vitamin D as a novel molecular target in gastric cancer therapies in association with the use of TSA ⁄ NaBu and 5-Aza Results Vitamin D induced apoptosis in gastric cancer ... polyclonal antibodies against PTEN (Abcam, Cambridge, MA, USA) or Egr-1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), and mouse monoclonal antibody against b-actin (Sigma) The signals were visualized...

Ngày tải lên: 22/03/2014, 21:20

11 540 0
Báo cáo khoa học: dehydrogenase from Arabidopsis thaliana, a flavoprotein involved in vitamin C biosynthesis pot

Báo cáo khoa học: dehydrogenase from Arabidopsis thaliana, a flavoprotein involved in vitamin C biosynthesis pot

... Recombinant AtGALDH migrated in SDS PAGE as a single band with an apparent molecular mass of approximately 55 kDa (Fig 3) This value is in fair agreement with the calculated molecular mass (58.8 kDa) ... have a similar stabilizing effect as a disulde bridge [30] Nevertheless, several aldonolactone oxidoreductases with a covalently bound FAD are less stable than AtGALDH ALO from Candida albicans ... catalase (232 kDa), aldolase (158 kDa), BSA (68 kDa) and ovalbumin (43 kDa) were obtained from Pharmacia Biotech (Uppsala, Sweden) l-Galactono-1,4-lactone, l-gulono-1,4lactone, d-gulono-1,4-lactone,...

Ngày tải lên: 23/03/2014, 07:20

14 333 0
Báo cáo khoa học: Mechanism of the ring contraction process in vitamin B12 biosynthesis by the anaerobe Propionibacterium shermanii under aerobic conditions docx

Báo cáo khoa học: Mechanism of the ring contraction process in vitamin B12 biosynthesis by the anaerobe Propionibacterium shermanii under aerobic conditions docx

... functionalities in precorrin-3x J Am Chem Soc 116, 4991–4992 11 Kurumaya K, Okazaki T, Seido N, Akasaka Y, Kawajiri Y, Kajiwara M & Kondo M (1989) A facile synthesis of d-aminolevulinic acid (ALA) ... 13C,18O -vitamin B12 biosynthesized aerobically and anaerobically in P shermanii are compared (Table 1), the 18O-retention ratios are almost identical These results show that vitamin B12 was biosynthesized ... spectrometer (Jasco Corp., Tokyo, Japan) The air pump was a Nisso INNOb4000 (Nisso Co., Saitama, Japan) Aerobic or anaerobic feeding experiments with [1-13C]ALA and [1-13C,1,1,4-18O3]ALA in P shermanii...

Ngày tải lên: 23/03/2014, 09:20

7 443 0
Báo cáo khoa học: An alternative pathway of vitamin D2metabolism Cytochrome P450scc (CYP11A1)-mediated conversion to 20-hydroxyvitamin D2and 17,20-dihydroxyvitamin D2 pot

Báo cáo khoa học: An alternative pathway of vitamin D2metabolism Cytochrome P450scc (CYP11A1)-mediated conversion to 20-hydroxyvitamin D2and 17,20-dihydroxyvitamin D2 pot

... Vitamin D2 metabolism by P450scc A Slominski et al lineages, and protection of DNA against oxidative damage and action as a cell membrane antioxidant [1,3,6,7] Structurally, vitamin D2 ... The rate of vitamin D2 metabolism by purified P450scc To obtain an estimate of the initial rate of vitamin D2 metabolism by P450scc, vitamin D2 at a molar ratio to phospholipid of 0.4 was incubated ... UV absorbance spectra characteristic of the vitamin D triene, with kmax at 265 nm and kmin at 228 nm, and displayed a molecular ion [M + 1]+ at m ⁄ z ¼ 413 and a major fragment ion at m ⁄ z ¼...

Ngày tải lên: 23/03/2014, 10:21

11 321 0
Báo cáo Y học: Biosynthesis of vitamin B2 An essential zinc ion at the catalytic site of GTP cyclohydrolase II ppt

Báo cáo Y học: Biosynthesis of vitamin B2 An essential zinc ion at the catalytic site of GTP cyclohydrolase II ppt

... GCAAATGGGATCCACAATGCAAGAGG CATTCCGAATCTCTGACTGGTGAC GTCACCAGTCAGAGATTCGGAATG GCTTGCTGTCTGATTGTGGCTTC GAAGCCACAATCAGAACGCAAGC GCGCTGCGATTCCGGCTTCCAGC GCTGGAAGCCGGAATCGCAGCGC Table Micro-organisms and plasmids used ... ribA Designation Primer orientation MF BamH1rev P-C54S-f P-C54S-r P-C65S-f P-C65S-r P-C67S-f P-C67S-r + – + – + – + – Sequence ACACAGAATTCATTAAAGAGGAGAAATTAACCATG GCAAATGGGATCCACAATGCAAGAGG CATTCCGAATCTCTGACTGGTGAC ... Aae, Aquifex aeolicus; Aac, Actinobacillus actinomycetemcomitans; Apl, Actinobacillus pleuropneumoniae; Ath, Arabidopsis thaliana; Bsu, Bacillus subtilis; Cmu, Chlamydia muridarum; Cpn, Chlamydophila...

Ngày tải lên: 23/03/2014, 21:20

7 367 0
Báo cáo khoa học: Anti-arthritis effects of vitamin K2 (menaquinone-4) ) a new potential therapeutic strategy for rheumatoid arthritis doc

Báo cáo khoa học: Anti-arthritis effects of vitamin K2 (menaquinone-4) ) a new potential therapeutic strategy for rheumatoid arthritis doc

... conducted a caspase activity assay MK-4 activated caspase assay in a dose-dependent manner (Fig 2C) By contrast, vitamin K1 did not show any effects on caspase activity and DNA fragmentation (data not ... six patients with RA and synoviocytes were maintained in separate cultures These patients had active RA as defined by the clinical criteria of the American Rheumatism Association [25] All RA patients ... isothiocyanate apoptosis kit (Takara Bio Inc., Shiga, Japan) 4592 CIA model in rats Seven-week-old female dark agouti rats were obtained from Japan SLC, Inc (Shizuoka, Japan) 0.3% Collagen type...

Ngày tải lên: 30/03/2014, 03:20

7 455 0

Bạn có muốn tìm thêm với từ khóa:

w