aya is a excellent student and plays sport very well

Báo cáo y học: " Attention Deficit Hyperactivity Disorder (ADHD) among longer-term prison inmates is a prevalent, persistent and disabling disorder" pdf

Báo cáo y học: " Attention Deficit Hyperactivity Disorder (ADHD) among longer-term prison inmates is a prevalent, persistent and disabling disorder" pdf

... psychiatric outpatients Finally, the neuropsychological tests were similar as for the other groups Statistical analysis Descriptive statistics summarised demographic data and clinical characteristics ... 6% among healthy controls, thus reflecting a remarkably lower educational level among prison inmates Standardised questionnaires Clinical characteristics of ADHD among adult male prison inmates ... Gunnar Johansson at Norrtälje Prison for invaluable help in administering the screening survey, Monica Hellberg for administrative assistance, and coinvestigators Michaela Wallensteen, Ann-Charlotte...

Ngày tải lên: 11/08/2014, 16:22

13 435 1
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

... arabinogalactan consists of 99% D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan consists of 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan consists of ... D-galactose and D-galacto-oligosaccharides The calculated areas for D-galactose and D-galacto-oligosaccharides were expressed as percentages of the area of mM D-galactose A niger b-1,4-endogalactanase ... Standard methods were used for other DNA manipulations, such as Southern analysis, subcloning, DNA digestions, and lambda phage and plasmid DNA isolations [23] Chromosomal DNA was isolated as...

Ngày tải lên: 21/02/2014, 01:21

9 669 0
Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

... Graduate Management Admission Test, which is a standardized exam given at various locations in the United States and Canada and around the world Throughout North America and in many international ... a margin as any candidate in the state’s history (C) having been reelected with as wide a margin as any candidate in the state’s history (D) she was reelected with as wide a margin as any candidate ... as wide of a margin as any candidate in the state’s history (A) she was reelected with as wide of a margin as any candidate in the state’s history (B) she had been reelected with as wide of a...

Ngày tải lên: 20/01/2014, 20:20

696 1K 1
Tài liệu Chapter 19. Mail and Address Book Email is a fast, cheap, convenient communication medium. pptx

Tài liệu Chapter 19. Mail and Address Book Email is a fast, cheap, convenient communication medium. pptx

... they're easy to set up and maintain, and because they offer many of the same features as IMAP servers Luckily, Mail can read and send email through Exchange servers as though your Mac were just another ... a fifth kind, but if you follow the instructions at http://members.aol.com/adamkb/aol/mailfaq/imap/applemail.html, you can read your AOL mail as if it came from a regular IMAP account.) POP accounts(Post ... Mail on the laptop, you'll find your messages and attachments already in place IMAP servers (Internet Message Access Protocol) are newer and have more features than POP servers, but aren't as...

Ngày tải lên: 21/01/2014, 06:20

5 383 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement ... (Duchefa, Haarlem, The Netherlands) Tissues were cleared in ethanol and visualized with a stereomicroscope (Leica MZ16FA) RNA isolation and real-time quantitative RT-PCR analysis RNA was isolated ... PTI1-4 (At2g47060) was cloned in the pBD-GAL4 cam (Stratagene, La Jolla, CA, USA) and were each used as bait to screen an Arabidopsis pACT2 cDNA library [36] The yeast strain PJ69- 4A [37] containing...

Ngày tải lên: 14/02/2014, 19:20

11 701 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... forming a cavity  11 A in height The size of this cavity is comparable with that of adeninelacking cobalamins, and thus allows the damaged 4940 Materials Crystalline AdoCbl was a gift from Eisai ... densitometric analysis Therefore, it was demonstrated that bands i and vi are (aDbDcD)2Ỉ(aRỈaRbR) and (aDbDcD)2Ỉ(aRỈaRbR)2 complexes, respectively We named the former the enzymreactivase (1 : 1) complex and ... release of adenine-lacking cobalamins, such as CN-Cbl and damaged cofactor The fact that the relative efficiencies of metal ions for the reactivation are not always correlated with the ATPase activity...

Ngày tải lên: 15/02/2014, 01:20

13 621 0
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

... transfected with pCDNA3.1 Zeo+ and MT1/MYC (lane 2), pCDNA3.1 Zeo+ and GRASP55F (lane 3) and MT1/MYC and GRASP55F (lane 4) were immunoprecipitated with the FLAG M2 monoclonal antibody and the associated ... Zeo+ and MT1/ MYC (lane 1), pCDNA3.1 Zeo+ and GRASP55F (lane 2), pCDNA3.1 Zeo+ and MT1 LLY/MYC (lane 3), GRASP55F and MT1 LLY/MYC (lane 4) and GRASP55F and MT1/MYC (lane 5) were immunoprecipitated ... permeabilized and stained with polyclonal antibodies against furin and GRASP55 Arrows show examples of membrane compartment containing GRASP55 and furin Scale bar = 10 lm C GRASP55 Furin contrast,...

Ngày tải lên: 18/02/2014, 04:20

18 603 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG...

Ngày tải lên: 19/02/2014, 05:20

14 517 0
Tài liệu Báo cáo khoa học: "TREATMENT OF LONG DISTANCE DEPENDENCIES IN LFG AND TAG: FUNCTIONAL UNCERTAINTY IN LFG IS A COROLLARY IN TAG" ppt

Tài liệu Báo cáo khoa học: "TREATMENT OF LONG DISTANCE DEPENDENCIES IN LFG AND TAG: FUNCTIONAL UNCERTAINTY IN LFG IS A COROLLARY IN TAG" ppt

... holds, where sy is a string in a, or f = v and e E a The functional uncertainty approach may be characterized as a localization of the long distance dependencies; a localization at the level of ... E T W O FORMALISMS We have compared LFG and TAG analyses of long distance dependencies, and have shown that what functional uncertainty does for LFG comes out as a corollary in TAG, without going ... linguistic relevance may be found in (Kroch and ao hi [51) 2.1 X brooc FEATURE STRUCTURE BASED TREE ADJOINING GRAMMARS (FTAG) In unification grammars, a feature structure is associated with a node...

Ngày tải lên: 21/02/2014, 20:20

8 609 0
Pitch and throw, grasp and know - what is a synonym

Pitch and throw, grasp and know - what is a synonym

... Jump and leap r, soa nd ya Fl and doze an d sle ep Richness and depth are what synonyms raise when they’re used in a paragraph, Sentence, or phrase A lovely and pretty and beautiful city A cat ... Rink: What Is a Noun? and Hairy, Scary, Ordinary: What Is an Adjective?, and of Rainbow Soup: Adventures in Poetry He lives in Cleveland, Ohio BRIAN GABLE is the illustrator of Dearly, Nearly, ... what is a synonym? / by Brian P Cleary; illustrated by Brian Gable p cm — (Words are categorical) eISBN: 1-57505-907-X English language—Synonyms and antonyms—Juvenile literature I Gable, Brian,...

Ngày tải lên: 02/03/2014, 04:25

33 2K 0
Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx

Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx

... with anti-PAD V (N) and LCA, and (I – L) double labeled with ABL2 and LCA All anti-PAD V labeling is shown in green, except in A where it is red DNA stain in A is green ABL2 labeling is green and ... and J – L) of zona intact 8-cell embryos (A – F) and blastocysts (G – L) labeled with LCA (red) and ABL2 (green) A and D show the LCA labeling in the zona pellucida (arrowhead) B and E show ABL2 ... III, PAD IV, and ePAD) have been cloned and sequenced in mice PAD II is found in various tissues including skeletal muscle, uterus, spinal cord, salivary glands, and pancreas [43] PAD I and PAD...

Ngày tải lên: 05/03/2014, 17:20

22 519 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast strains used in this study Strain Genotype ... mutagenesis Primer Sequence (5¢- to 3¢) Vps4–DEL F Vps4–DEL R Vps4–TRP F Vps4–TRP R Vps4–RDF F Vps4–RDF R TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA ... other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing feature of members of the meiotic clade of AAA ATPases is the SRH motif,...

Ngày tải lên: 07/03/2014, 05:20

23 491 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

... and a sense cDNA probe (complementary to the antisense) for mouse Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT ... genes and connective tissue patterning Development 121, 693–705 16 Ozaki H, Watanabe Y, Takahashi K, Kitamura K, Tanaka A, Urase K, Momoi T, Sudo K, Sakagami J, Asano M et al (2001) Six4, a putative ... S, Nagahama H, Shu Y, Hoshi S, Nakayama K, Nakayama KI & Nagata M (2002) Glomerular differentiation in p27 and p57 double-mutant metanephroi Anat Embryol 206, 31–36 Sung KW, Kirby M, McDonald...

Ngày tải lên: 07/03/2014, 17:20

16 476 0
Báo cáo khoa học: A DmpA-homologous protein from Pseudomonas sp. is a dipeptidase specific for b-alanyl dipeptides Hidenobu Komeda and Yasuhisa Asano docx

Báo cáo khoa học: A DmpA-homologous protein from Pseudomonas sp. is a dipeptidase specific for b-alanyl dipeptides Hidenobu Komeda and Yasuhisa Asano docx

... L-Ala-(Gly)2 (L-Ala)2, L-Ala-D-Ala, L-Ala-D-Ala-L-Ala, DL-Ala-DL-Asn, DL-Ala-DL-Ile, DL-Ala-DL-Leu, DL-Ala-DL-Met, DL-AlaDL-Phe, DL-Ala-DL-Ser, DL-Ala-DL-Val, L-Asp-D-Ala, L-Pro-Gly, L-ProL-Phe, c-Aminobutyryl-L-His ... L-Ala-pNA D-Ala-NH2 L-Ala-NH2 D-Ala-(Gly)2 L-Ala-(Gly)2 b-Ala-L-Ala b-Ala-Gly b-Ala-NH2 b-Ala-L-His (Carnosine) b-Ala-L-Leu (b-Ala)2 similarity to that from dmpA of O anthropi LMG7991 DmpA has been ... Pseudomonas aeruginosa and Lactobacillus delbrueckii ssp lactis DSM 7290 Van der Drift and Ketelaars have isolated a bacterium hydrolyzing b-Ala-l-His (l-carnosine) and identified it as P aeruginosa...

Ngày tải lên: 07/03/2014, 21:20

10 406 0
What is a Mouse-Trap Car and How does it Work? pdf

What is a Mouse-Trap Car and How does it Work? pdf

... car that travels faster, farther and wastes less energy The most common area where surface friction will occur is between the axle and the chassis The interface between the axle and the chassis ... air is affected by fluid friction and a block sliding on a table is mainly affected by surface friction as well as a little air resistance The greater the amount of friction between two surfaces, ... of all right triangles Ancient mathematicians found that all right triangles are proportional by ratios of their sides and angles These ratios times the angle are known as sine, cosine, and tangent...

Ngày tải lên: 16/03/2014, 12:20

15 704 3
Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx

Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx

... Identification and characterization of two putative human arginine methyltransferases (HRMT1L1 and HRMT1L2) Genomics 48, 330–340 Yanagida M, Hayano T, Yamauchi Y, Shinkawa T, Natsume T, Isobe T & Takahashi ... RACK1 and is a substrate for the phosphorylation by phorbol 12-myristate 13-acetate activated protein kinase C J Biol Chem 279, 11444–11455 12 Ozaki T, Watanabe K-I, Nakagawa T, Miyazaki K, Takahashi ... protein methylation Adox, lyzed and fractionated in nuclear (lanes and 4) and cytoplasmic (lanes and 3) fractions Ki-1 ⁄ 57 was immunoprecipitated (lanes 1–4) and then submitted to methylation by...

Ngày tải lên: 16/03/2014, 13:20

16 368 0
Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

... suggested as one of the targets for a signal transduction pathway mediated by PknA and PknB If so, this pathway could link cell division and peptidoglycan synthesis with arabinogalactan synthesis, another ... cell division Eur J Biochem 269, 1078–1085 Sharma K, Chandra H, Gupta PK, Pathak M, Narayan A, Meena LS, D’Souza RC, Chopra P, Ramachandran S & Singh Y (2004) PknH, a transmembrane Hank’s type ... characterization and localization Microbiology 147, 2307–2314 12 Gopalaswamy R, Narayanan PR & Narayanan S (2004) Cloning, overexpression, and characterization of a serine ⁄ threonine protein kinase...

Ngày tải lên: 16/03/2014, 14:20

11 402 0
w