avoiding even a remote possibility of conflict by granting autonomy

Báo cáo khoa học: Molecular basis of perinatal hypophosphatasia with tissue-nonspecific alkaline phosphatase bearing a conservative replacement of valine by alanine at position 406 Structural importance of the crown domain potx

Báo cáo khoa học: Molecular basis of perinatal hypophosphatasia with tissue-nonspecific alkaline phosphatase bearing a conservative replacement of valine by alanine at position 406 Structural importance of the crown domain potx

... infantile hypophosphatasia, (c) childhood hypophosphatasia, (d) adult hypophosphatasia and (e) odonto hypophosphatasia [1–4] Perinatal and infantile forms of hypophosphatasia are severe and are ... hypophosphatasia Eur J Med Genet 50, 367–378 Cai G, Michigami T, Yamamoto T, Yasui N, Stomura K, Yamagata M, Shima M, Nakajima S, Mushiake S, Okada S et al (1998) Analysis of localization of mutated tissue-nonspecific ... V406I, 5¢-CCT GGC TAC AAG ATA GTG GGC GGT GAA-3¢ and 5¢-TTC ACC GCC CAC TAT CTT GTA GCC AGG-3¢; and V406F, 5¢-CCT GGC TAC AAG TTC GTG GGC GGT G-3¢ and 5¢-CAC CGC CCA CGA ACT TGT AGC CAG G-3¢, respectively...

Ngày tải lên: 07/03/2014, 05:20

11 500 0
A Half-Century of Conflict, Volume II pdf

A Half-Century of Conflict, Volume II pdf

... CHAPTER XXII 1745-1747 ACADIAN CONFLICTS Efforts of France. Apathy of Newcastle. Dilemma of Acadians. Their Character. Danger of the Province. Plans of Shirley. Acadian Priests. Political Agitators. ... Great War-Party. He attacks Fort Massachusetts. Sergeant Hawks and his Garrison. A Gallant Defence. Capitulation. Humanity of the French. Ravages. Return to Crown Point. Peace of Aix-la Chapelle ... our day as a separate community Their enemies the Chickasaws, Osages, Arkansas, and even the distant Illinois, waged such deadly war against them that, according to La Harpe, the unfortunate Nassonites...

Ngày tải lên: 24/03/2014, 03:21

107 274 0
A Half Century of Conflict - Volume I pptx

A Half Century of Conflict - Volume I pptx

... were exchanged and brought home His daughter Freedom was converted, baptized under the name of Marie Françoise, and married to Jean Daulnay, a Canadian His daughter Martha was baptized as Marguerite, ... snow-shoes, and they gave him those painful cramps of the legs and ankles called in Canada mal la raquette One morning at dawn he was waked by his chief master and ordered to get up, say his prayers, and ... prisoner in Indian hands Half starved and bearing a heavy load, she followed her captors in their hasty retreat towards Canada After a time she was safely delivered of an infant in the midst of the winter...

Ngày tải lên: 31/03/2014, 21:20

157 280 0
A SIMPLE EXPLANATION OF MONEY By Isuru Abeysinghe potx

A SIMPLE EXPLANATION OF MONEY By Isuru Abeysinghe potx

... have a half-chicken and an apple, Jane would have an axe and a half-chicken and Peter would have an axe and a cup It’s getting complicated – and there are only three people involved! Additionally, ... of that, nobody will trade today, because between Adam and Jane (and also between Jane and Peter) there are no items of barter that each party is happy with Now, we are all thinking the same thing: ... Roman days, and in pre-colonial India, salt was used as currency: because it was universally useful Because salt was the only preservative available, everybody needed it to be able to store meat...

Ngày tải lên: 27/06/2014, 23:20

4 227 0
Báo cáo y học: "Non union of scaphoid fracture in a cricketer – possibility of a stress fracture: a case report" ppsx

Báo cáo y học: "Non union of scaphoid fracture in a cricketer – possibility of a stress fracture: a case report" ppsx

... Scaphoid stress fracture in a 13 year old gymnast: A case report J Hand Surg (Am) 2000, 25(4):710-3 Hanks GA, Kalenak A, Bowman LS, Sebastanelli WJ: Stress fracture of the carpal scaphoid, a ... sports As non union of a scaphoid fracture can cause degenerative arthritis of the radio-carpal articulation any sports person presenting with wrist pain should be investigated for a scaphoid fracture ... ciated radiocarpal arthritis Scaphoid views showing non union of the scaphoid with assoScaphoid views showing non union of the scaphoid with associated radiocarpal arthritis in the stress fracture...

Ngày tải lên: 11/08/2014, 10:22

2 222 0
A contrastive analysis of apologizing by english and vietnamese speakers

A contrastive analysis of apologizing by english and vietnamese speakers

... responsibility, an offer to repair, an explanation or account of the situation and a promise of forbearance After that, Blum-Kulka and Olshtain (1984) rearranged the five semantic principles of Olshtain and ... offended want to offer an apology, it means they express their goal of humiliating the partner In this situation, an apology is regarded as a face-threatening act for the speaker and a face-saving act ... question, data was presented in tables and charts to facilitate the synthesis, comparison and generalization of data Graphs were principally used to analyze and compare figures in a general sense,...

Ngày tải lên: 17/07/2015, 10:56

84 937 7
TOWARDS A COMPREHENSIVE APPROACH OF SEXUAL AND REPRODUCTIVE RIGHTS AND NEEDS OF WOMEN DISPLACED BY WAR AND ARMED CONFLICT pptx

TOWARDS A COMPREHENSIVE APPROACH OF SEXUAL AND REPRODUCTIVE RIGHTS AND NEEDS OF WOMEN DISPLACED BY WAR AND ARMED CONFLICT pptx

... comprehensive approach of SRH still constitutes a real challenge for donors, international humanitarian agencies, national authorities, national and international non-governmental organizations, and community ... iron and folic acid Some diseases can also cause anaemia by destroying the red blood cells Anaemia in pregnancy: Anaemia in pregnancy is defined as a haemoglobin concentration of less than 110 ... distribution of health or disease in a population are collected, collated, analysed, and disseminated Traditional birth attendant (TBA): A trained or untrained birth attendant who traditionally assists...

Ngày tải lên: 28/03/2014, 14:20

41 470 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

... gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc in this study BACT1369F PROK1492R TM1389BACT2 ... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... 61-72 Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake...

Ngày tải lên: 05/09/2013, 10:15

9 522 0
Ecological Assessment of Water Quality by Three-species Acute Toxicity Test and GC/MS Analysis - A Case Study of Agricultural Drains

Ecological Assessment of Water Quality by Three-species Acute Toxicity Test and GC/MS Analysis - A Case Study of Agricultural Drains

... to quantify the ecotoxicity level of river water from an urban area in Japan and agricultural drains when agricultural chemicals are applied In addition, analysis of agricultural chemicals by GC/MS ... tests as indicators of decontamination in composting oily waste, Ecotoxicol Environ Saf., 47, 156-166 Liu R., Kameya T., Sawai A and Urano K (2007) Application of a larval medaka assay to evaluate ... Sagami Bay Fig - Location of sampling sites (Kanagawa Prefecture, Japan) Preparation of Samples for Analysis All water samples were filtrated using a μm glass fiber filter, and then concentrated...

Ngày tải lên: 05/09/2013, 10:15

8 670 0
a discourse analysis of opening and closing speeches by  masters of ceremonyon reality television showsin american english versus vietnames

a discourse analysis of opening and closing speeches by masters of ceremonyon reality television showsin american english versus vietnames

... Use of Informal Language in AOSs and VOSs Based on the data, a large number of vocabularies used in AOSs are informal contractions and slangs Contraction is defined by Oxford Advanced Learner ... language, vocabulary derived from Latin That is why formal spoken language has many features very similar to written texts, particularly absence of vernacular vocabulary and slang, as well as the ... greatest fear a person can have That fear can be much greater than the phobia of snake, traveling by air or even death The quote by Jerry Seinfeld explains this very well in a humorous way Many...

Ngày tải lên: 26/11/2013, 12:41

145 802 1
A discourse analysis of english speeches delivered by guest speakers at graduation ceremonies in US colleges and universities

A discourse analysis of english speeches delivered by guest speakers at graduation ceremonies in US colleges and universities

... example (4.73) We can try to build walls around us, and we can look inward, and we can respond by being frightened and angry about those disruptions [5] In grammar, parallelism is a balance of ... similar words, phrases, or clauses As shown in the above example, in (4.73) parallel structures are made up at clause level At lower level of parallel, word balancing with word appears popularly: ... DISCUSSIONS 4.1 LAYOUT FEATURES OF ENGLISH GRADUATION SPEECHES Layout is identified as the way in which the parts of something are arranged, and the layout of a graduation speech is the way in which...

Ngày tải lên: 26/11/2013, 13:27

13 840 2
A discourse analysis of english oscar acceptance speeches delivered by film award winners in the USA

A discourse analysis of english oscar acceptance speeches delivered by film award winners in the USA

... conversation analysis by Cook[9], speech events and contextual analysis by Hatch [23] cohesion by Halliday and Hassan [20], etc To the best of my knowledge, although there have been many researches ... has made a great contribution to art /science/politics/etc.[62] 2.2.8.3.Some Notes on the Oscar Wikipedia cites “An Academy Award, also known as the Oscar, is granted by the American Academy of ... General Features of Oscar Acceptance Speeches 2.2.8.1 Acceptance Speech as a Type of Discourse 2.2.8.2 Notions of Acceptance Speech An acceptance speech is a speech delivered on accepting some award...

Ngày tải lên: 26/11/2013, 13:28

13 853 2
A discourse analysis of presuppositions in the declaration of independence made by president ho chi minh = phân tích diễn ngôn các tiền giả định trong tuyên ngôn độc lập của chủ tịch hồ chí minh

A discourse analysis of presuppositions in the declaration of independence made by president ho chi minh = phân tích diễn ngôn các tiền giả định trong tuyên ngôn độc lập của chủ tịch hồ chí minh

... War II was in the final stage World War II was the war between two factions: the Allies including Britain, France, America and Russia, and the Fascism including Japan, Germany and Italy The Fascists ... were already standing in the border At that time, the conflict between Britain-France-America and Russia might lead Britain and America to make concessions with France and allow France to come back ... effect of what he speaks On the contrary, the writer has the advantage of taking more time in choosing lexis and organizing ideas He can rearrange what has been written and make changes if he wants...

Ngày tải lên: 14/12/2013, 00:41

47 1,5K 10
An analysis of nouns formed by suffixes in english   a case study of the textbook solutions   pre intermedite

An analysis of nouns formed by suffixes in english a case study of the textbook solutions pre intermedite

... exclusively to female humans and animals Eg:  Lion (Noun): a large powerful animal of the cat family that hunts in group and lives in parts of Africa and southern Asia  Lioness (Noun): a female lion ... morpheme may be defined as the minimal linguistics sign, a grammatical unit that is an arbitrary union of a sound and a meaning and that cannot be further analyzed This definition may be too ... of plants and animals)  “GRAM” – (It means “written”): telegram (a message sent by telegraph and then printed and given to somebody), grammar (the rules in a language for changing the form of...

Ngày tải lên: 14/12/2013, 16:45

63 990 3
A new algorithm for enumeration of minimum cutsets of graph by branch addition

A new algorithm for enumeration of minimum cutsets of graph by branch addition

... Billinton and C Singh, ''Generating capacity reliability evaluation in interconnected systems using a frequency and duration approach, Part I: Mathematical analysis,'' IEEE Trans on Power Apparatus ... Enumeration of Minimal Cutsets Separating Vertices in a Class of Undirected Planar Graphs," IEEE Trans on Reliability, Vol 41, No 1, March 1992 Li Yan, Hamdy A Taha, Thomas L Landers, "A Recursive ... figure and its minimum cutsets for output node are shown in Table The calculations have made by Matlab version 6.5 The cutsets of this graph have calculated in 0.8 second This algorithm also has applied...

Ngày tải lên: 03/01/2014, 19:35

6 545 0
Tài liệu Crafting a Rule of Life by Stephen A macchia docx

Tài liệu Crafting a Rule of Life by Stephen A macchia docx

... “Eat the bread, you are hungry Eat the bread.” And she said, “I’m afraid that when the bread is finished, I will be hungry again.” So small, she was afraid of being hungry again She has already ... understanding and engaging what nonviolence is all about.” Nonviolence as a way to pursue justice and reconciliation is, for Sami, a source of transformation and healing Sami Awad has dedicated his ... Alexia Salvatierra, Daniel Hill, Efrem Smith, Larry Martin, Mark Labberton and Gary Burge (United States) Each chapter also includes a section on contemporary praxis (reflection paired with action)...

Ngày tải lên: 14/02/2014, 07:20

32 389 0
Tài liệu Báo cáo khoa học: Kinetics of dextran-independent a-(1 fi 3)-glucan synthesis by Streptococcus sobrinus glucosyltransferase I pdf

Tài liệu Báo cáo khoa học: Kinetics of dextran-independent a-(1 fi 3)-glucan synthesis by Streptococcus sobrinus glucosyltransferase I pdf

... Methyl a- d-glucopyranoside was used as a glucose analog that is not a substrate of hexokinase in a glucose assay system The data were analyzed on the basis of the Michaelis–Menten equation; the maximum ... ORIGIN software package (v 6.1J) The data from the GS nigeropentaose reaction were analyzed by nonlinear least-squares analysis, but the parameters were not obtained with reasonable accuracy Because ... that the nigerooligosaccharides were marginally accumulated and that they constituted a small proportion of the oligosaccharides with a wide range of DP values A Glucosyl transfer activity of...

Ngày tải lên: 14/02/2014, 22:20

10 676 0
Tài liệu A Manual of the Operations of Surgery, by Joseph Bell doc

Tài liệu A Manual of the Operations of Surgery, by Joseph Bell doc

... Ligature of Innominate Ligature of third part of Left Subclavian Ligature of Axillary in its first part 10 Ligature of Axillary in its third part 11 Ligature of Brachial 12 Amputation of Arm by ... Operations on Air Passages, 241 XXXII Diagram illustrating Operations for Hernia, 253 XXXIII Diagram of an Artificial Anus, 257 XXXIV Diagram of Section of Prostate, 259 XXXV Diagram of Membranous ... I LIGATURE OF ARTERIES PAGE Ligature of Arteries— General Maxims —Ligature of Aorta—Iliacs— Gluteal— Femoral— Popliteal— Innominate— Carotids— Lingual— Subclavian— Brachial, etc., 1-45 CHAPTER...

Ngày tải lên: 17/02/2014, 07:20

1K 1,3K 0
Tài liệu A Short View of the Frauds and Abuses Committed by Apothecaries, by Christopher Merrett pptx

Tài liệu A Short View of the Frauds and Abuses Committed by Apothecaries, by Christopher Merrett pptx

... paper; but pure Chymical Oyls totally fly away, leaving the paper white as 'twas before, and not transparent, and in this way Oyl of sweet Almonds and Spike have a great share As for Oyls drawn ... search made only of Honey, and Bole-Armeniac Which false composition was taken away by the then Master of the Company S u c h Chymists which sell preparations honestly made complain, that few Apothecaries ... the said Act Now this Charter so much declaimed against, prayed only a supply of this defect, and also better and more necessary ways and means, without which, such and all other offenders against...

Ngày tải lên: 17/02/2014, 07:20

206 405 0
Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

... leaflets We thus conclude from these data that Ab interacts with the membrane in a Table Average values of deuterium order parameters Data are the mean (± SD) Top leaflet plateau region Simulation ... simulations compare well with experimental observations An early study by Mason et al [7] indicated that Ab40 was capable of penetrating into rat synaptic plasma membranes, thus decreasing bilayer thickness ... peptide are drawn to it by the interactions described above, whereas more distant lipids maintain a more canonical value for their lateral 3068 area This trend is apparent in all other simulations of...

Ngày tải lên: 18/02/2014, 08:20

16 475 0
w