authentication authorization and identification

... Registrar (AR) and Access Control Server (ACS) The RADIUS protocol carries authentication, authorization and configuration information between a NAS and a RADIUS authentication server Requests and responses ... IOS AAA client resides on a router or network access server (NAS) and can locally perform all authentication, authorization, and accounting functions This model does not scale because there can ... benefits: • Increased flexibility and control • Scalability • Standardized authentication methods (RADIUS, Terminal Access Controller Access Control System Plus [TACACS+], and Kerberos) The Cisco IOS...

Ngày tải lên: 15/03/2014, 16:20

... auxiliary, and console login, exec, and enable commands Packet (interface mode) Dial-up and VPN access including asynchronous and ISDN (BRI and PRI) ppp and network commands © 2012 Cisco and/ or its ... only.” • As with authentication, AAA authorization is configured by defining a “named” list of authorization methods, and then applying that list to various interfaces © 2012 Cisco and/ or its affiliates ... protocols TACACS and XTACACS – RADIUS • Remote Authentication Dial-In User Service © 2012 Cisco and/ or its affiliates All rights reserved 21 Implementing Local AAA Authentication © 2012 Cisco and/ or its...

Ngày tải lên: 12/10/2015, 02:46

... of the standard The symbols and designations in this standard can depict both hardware and function Sketches and technical papers will usually contain highly simplified symbolism and identification ... preface, footnotes, and appendices is included for information only and is not a part of the standard The instrumentation symbolism and identification techniques described in the standard accommodate ... instructions, and knowledge about measurement and control systems in the process industries This document is a consensus standard rather than a mandatory one As such, it has many of the strengths and the...

Ngày tải lên: 04/04/2013, 12:40

... the coordination and cooperation of public and private stakeholders in developing and enhancing the nation’s medical and public health preparedness Members include representatives and leaders from ... local, state, and federal governments; leaders of health professional and business associations; and other stakeholders and key decision makers The Preparedness Forum has a long-standing interest ... for Disease Control and Prevention (CDC) and others within the Department of Health and Human Services (HHS), as well as state and local health departments, the private sector, and others The workshop...

Ngày tải lên: 16/02/2014, 20:20

... Physics 24 (2008) 209-222 identification, dynamic response and so on Several literatures presented the POD’s application to decompose the spatially-correlated and multi-variate random pressure fields ... troublesome and difficulties in interpreting theses results In this paper, the POD based spectral and covariance matrices of the random field will be presented Both covariance-based and spectral-based ... orthogonal basic vectors which can expand a multi-variate random process into a sum of products of these basic orthogonal vectors and single-variant uncorrelated random processes Let consider the...

Ngày tải lên: 05/03/2014, 14:20

... detection and identification based on random multiplex (RT)-PCR using 3'-locked random primers to avoid primer-dimer amplification Once detected, virus amplification products can be shot-gun cloned and ... ctcagtctggttggtgaggttgaag 26523 Figure PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA Randomly amplified DNA from Adenovirus ... 2.1 Sequence of Randomly Amplified DNA Multi-Cloning Site C Figure PCR Screening and Sequencing of Randomly Amplified Coxsackie Virus A7 cDNA PCR Screening and Sequencing of Randomly Amplified...

Ngày tải lên: 18/06/2014, 18:20

... SDS and Triton X100 can greatly interfere with HPLC and mass spectrometric analysis [8] We tested the efficiency of OG in separating the virion components and found that the supernatant and pellet ... proteins (E6R and L3L) has not been described previously The peptides detected for each of these proteins are listed in Tables and The E6R ORF is situated between the E5R and E7R genes and produces ... E11L, G1L, G7L, H1L and J1R – all of which were identified in our analysis We also found membrane proteins (F9L, F10L, and E8R) and cytosolic proteins (A16L, E10R, F8L, G4L, and I3L) The remaining...

Ngày tải lên: 19/06/2014, 08:20

... detection and identification based on random multiplex (RT)-PCR using 3'-locked random primers to avoid primer-dimer amplification Once detected, virus amplification products can be shot-gun cloned and ... ctcagtctggttggtgaggttgaag 26523 Figure PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA Randomly amplified DNA from Adenovirus ... 2.1 Sequence of Randomly Amplified DNA Multi-Cloning Site C Figure PCR Screening and Sequencing of Randomly Amplified Coxsackie Virus A7 cDNA PCR Screening and Sequencing of Randomly Amplified...

Ngày tải lên: 20/06/2014, 01:20

... SDS and Triton X100 can greatly interfere with HPLC and mass spectrometric analysis [8] We tested the efficiency of OG in separating the virion components and found that the supernatant and pellet ... proteins (E6R and L3L) has not been described previously The peptides detected for each of these proteins are listed in Tables and The E6R ORF is situated between the E5R and E7R genes and produces ... E11L, G1L, G7L, H1L and J1R – all of which were identified in our analysis We also found membrane proteins (F9L, F10L, and E8R) and cytosolic proteins (A16L, E10R, F8L, G4L, and I3L) The remaining...

Ngày tải lên: 20/06/2014, 04:20

... conducted the RT-PCR and western blot ananlysis and was assisted in these experiments by JAB and JAAG MM and CR helped in designing appropriate Muc16 primers JC assisted in obtaining and maintaining ... Identification of soluble Muc16 and MUC16 by Western blotIdentification of soluble Muc16 and MUC16 by Western blotting Purified MUC16 (25 μg total protein/lane) from MOVCAR-2 (lane 1) and OVCAR-3 cells (lane ... human and murine forms of the mucin MUC16 is both expressed on the cell surface and shed from the cell in soluble forms Muc16, on the other hand, is detected primarily in the spent media and in...

Ngày tải lên: 20/06/2014, 07:20

... Symbols for self-actuated regulators, valves, and other devices 34 ANSI/ISA-5.1-1984 (R 1992) 6.6 Symbols for self-actuated regulators, valves, and other devices (contd.) ANSI/ISA-5.1-1984 (R ... devices (contd.) ANSI/ISA-5.1-1984 (R 1992) 35 6.6 Symbols for self-actuated regulators, valves, and other devices (contd.) 36 ANSI/ISA-5.1-1984 (R 1992) 6.7 Symbols for actuator action in event...

Ngày tải lên: 03/07/2014, 12:20

... preface, footnotes, and appendices is included for information only and is not a part of the standard The instrumentation symbolism and identification techniques described in the standard accommodate ... this end, the Society welcomes all comments and criticisms, and asks that they be addressed to the Secretary, Standards and Practices Board, ISA, 67 Alexander Drive, P.O Box 12277, Research Triangle ... instructions, and knowledge about measurement and control systems in the process industries This document is a consensus standard rather than a mandatory one As such, it has many of the strengths and the...

Ngày tải lên: 05/08/2014, 11:20

... standard is to establish a uniform means of designating instruments and instrumentation systems used for measurement and control To this end, a designation system that includes symbols and an identification ... activities 2.3.1 The standard is suitable for use whenever any reference to an instrument or to a control system function is required for the purposes of symbolization and identification Such references ... equipment symbols are not part of this standard, but are included only to illustrate applications of instrumentation symbols 2.2 Application to industries 2.2.1 The standard is suitable for use in the...

Ngày tải lên: 05/08/2014, 11:20

Ngày tải lên: 05/08/2014, 11:20

Ngày tải lên: 05/08/2014, 11:20

Ngày tải lên: 05/08/2014, 11:20

Ngày tải lên: 05/08/2014, 11:20

Ngày tải lên: 05/08/2014, 11:20

Ngày tải lên: 05/08/2014, 11:20

Ngày tải lên: 05/08/2014, 11:20