and or fauna as a basis for ecosystem delineation

RESEARCH ON PLANT DIVERSITY IN FOREST ECOSYSTEMS OF XUAN SON NATIONAL PARK  IN PHU THO PROVINCE AS a BASIS FOR PLANNING  AND CONSERVATION WORK

RESEARCH ON PLANT DIVERSITY IN FOREST ECOSYSTEMS OF XUAN SON NATIONAL PARK IN PHU THO PROVINCE AS a BASIS FOR PLANNING AND CONSERVATION WORK

... Representatives are often families of Rosaceae, Lauraceae, Apocynaceae, Theaceae, Magnoniaceae, Juglandaceae, Fagaceae, Aceraceae, etc (6) Xuan Son National Park has high differentiation on vegetation ... The secondary forest of restoration after exploitation: species are often Castanopsis armata, C tessellata, Lithocarpus elegan, Aglaia gigantea, Vatica odorata, Machilus odoratissima, Pterospermum ... Rosaceae, Lauraceae, Apocynaceae, Theaceae, Magnoniaceae, Juglandaceae, Fagaceae, Aceraceae, etc (6) Xuan Son National Park has high differentiation on vegetation types under altitudes

Ngày tải lên: 21/07/2016, 10:39

27 532 0
Geosite and Geomorphosite Assessment as a Tool for Geoconservation and Geotourism Purposes: a Case Study from Vizovická vrchovina Highland (Eastern Part of the Czech Republic)

Geosite and Geomorphosite Assessment as a Tool for Geoconservation and Geotourism Purposes: a Case Study from Vizovická vrchovina Highland (Eastern Part of the Czech Republic)

... – – – A considerable number of various types of landforms (cryogenic, gravitational and fluvial landforms, a large diversity of small weathering forms) Study area is a part of Natural park Vizovické ... geoparks, National Parks and Protected Landscape Areas (and also within some small-scale protected areas) is well known and promoted However, there are many sites outside the protected areas and ... geomorphology and tourism: geomorphology may be a tourist resource as part of the primary or original offer (geomorphological site as an attraction or geomorphological site as a support for tourist

Ngày tải lên: 30/12/2018, 14:47

11 167 0
Image and fractal analysis as a tool for evaluating salinity growth response between two salicornia europaea populations

Image and fractal analysis as a tool for evaluating salinity growth response between two salicornia europaea populations

... of data and materials The datasets used and/ or analysed during the current study are available from the corresponding author on reasonable request 14 Ethics approval and consent to participate ... ASJ contributed to the Random amplified polymorphic DNA analysis experiment SCP performed all tests SCP and AP produced the statistical analysis and dendrogram SCP and JCP developed fractal and ... multiple scales Therefore, our results confirm that fractal analysis used as a measure of plant progress was a useful non-destructive tool for a numerical and simple estimate of the biomass and complexity

Ngày tải lên: 28/06/2021, 20:55

14 5 0
Hydro wind and solar power as a base for

Hydro wind and solar power as a base for

... RESEARCH ARTICLE Hydro, wind and solar power as a base for a 100% renewable energy supply for South and Central America Larissa de Souza Noel Simas Barbosa1,2, Dmitrii Bogdanov3, Pasi Vainikka2, ... region was divided into 15 sub-regions: Central America (that accounts for Panama, Costa Rica, Nicaragua, Honduras, El Salvador, Guatemala and Belize), Colombia, Venezuela (that accounts for Venezuela, ... paper Geothermal data are evaluated based on existing information on the surface heat flow rate [28, 29] and surface ambient temperature for the year 2005 globally For areas where surface heat

Ngày tải lên: 25/01/2022, 08:35

28 4 0
Changes to admission to schools as a basis for consultation

Changes to admission to schools as a basis for consultation

... funded before formal approval Equalities Impact Assessment 7.4 An EIA is available for admissions to schools This EIA will be reviewed as part of the consultation and planning processes Strategic ... Learning Village at Blue Mountain, the Transport Research Laboratory site (TRL) near Crowthorne and in Warfield (on two sites, West and East) 6.5 11-13 additional primary forms of entry (FE) and ... Village Academy Sec’y & Primary 2017 TRL Expansion Primary 2018 Amen Corner North Academy Primary 2018 Amen Corner South Academy Primary TBA Warfield East Academy Primary TBA Secondary school admission

Ngày tải lên: 23/10/2022, 08:20

12 3 0
Habermas Sociological Theory as a Basis for Clinical Practice wi

Habermas Sociological Theory as a Basis for Clinical Practice wi

... Sociological Theory as a Basis for Clinical Practice with Small Groups Valerie Ann Malhotra Texas Woman's University ABSTRACT Jurgen Habermas' sociological analysis of "power-distorted" communication, ... this and additional works at: http://digitalcommons.wayne.edu/csr Recommended Citation Malhotra, Valerie Ann (1987) "Habermas' Sociological Theory as a Basis for Clinical Practice with Small Groups," ... Maher and Carol Stabel who served as group leaders Deneen, Maher, Stabel, as well as Jerrian Stem, Ann Tidball, Tamera Bryant, Dai-Na Sun, Beth Germscheid, and Cathy Pruit also served as research

Ngày tải lên: 30/10/2022, 21:28

13 3 0
Evaluation of region selective bilirubin induced brain damage as a basis for a pharmacological treatment

Evaluation of region selective bilirubin induced brain damage as a basis for a pharmacological treatment

... modified media does not affect this assay No differences were detected for any brain region or at any post-natal age (data not shown) Based on these results, Bf treatment was initiated at day in vitro ... brain that conserve cellular heterogeneity and connections12 and exhibit synaptic plasticity and can reveal mechanisms of pathological insults comparable to what is obtained in vivo OBCs are easily ... severity and occurrence of the above reported symptoms8 A possible reason for this variability has been attributed to the level and duration of hyperbilirubinemia9 As learned from other neonatal neurological

Ngày tải lên: 24/11/2022, 17:52

12 4 0
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx

Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx

... SIV2-U 5’ AGTATGGGCAGCAAATGAAT 3’ (forward primer), SIV2-D 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA (TaqMan probe) The signal was finally compared ... by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All experiments were performed following institutional animal care and use ... http://www.retrovirology.com/content/7/1/21 Page 10 of 19 [...]... Welfare Act and The Guide for the Care and Use of Page 14 of 19 Laboratory Animals, as well as according to animal care standards deemed acceptable by

Ngày tải lên: 12/08/2014, 23:23

19 317 0
Báo cáo y học: "Patient throughput times and inflow patterns in Swedish emergency departments. A basis for ANSWER, A National SWedish Emergency Registry" ppt

Báo cáo y học: "Patient throughput times and inflow patterns in Swedish emergency departments. A basis for ANSWER, A National SWedish Emergency Registry" ppt

... Sweden, and forms the basis for ANSWER. In the studied six EDs, Monday was the busiest and Sa turday the least busy day. All EDs had a large increase in patient inflo w before noon and a slow ... et al. [16], and are as follows: • Time of patient arrival at EDs A, B, D, E and F was definedasthetimewhenthepatientarrivedatthe reception desk. Time of patient arrival at ED C was defined as ... the feasibility of collecting selected quality of care data from six different Swedish EDs using auto- mated data capture as a basis for a national quality of care registry , and the other was to

Ngày tải lên: 13/08/2014, 23:20

10 270 0
broadband as a platform for economic, social and cultural development - lessons from asia - bb as a platform, oecd, 19 nov

broadband as a platform for economic, social and cultural development - lessons from asia - bb as a platform, oecd, 19 nov

... DRAFT 1 Broadband as a platform for economic, social and cultural development: Lessons from Asia Valerie D’Costa, Programme Manager, and Tim Kelly, Lead ICT Policy Specialist, infoDev ... Bank, adapted from ITU World Telecommunication Indicators Database and AT&T. [...]... Broadband Korea: Internet Case Study”, March 2003, available at: http://www.itu.int/ITU-D/ict/cs/korea/material/CS_KOR.pdf ... http://www.itu.int/ITU-D/ict/cs/korea/material/CS_KOR.pdf 3 See Rappoport, Paul N., Kridel, Donald J and Taylor, Lester D 2002 “The Demand for Broadband: Access, Content and the Value of Time.” Washington, DC available at:

Ngày tải lên: 21/08/2014, 15:25

16 269 0
foucault and kadan-limit order book as a market for liquidity

foucault and kadan-limit order book as a market for liquidity

... Goldstein and Kavajecz (2000), Handa and Schwartz (1996), Harris and Hasbrouck (1996), Holli¯eld, Miller and Sandas (200 1a, b), Kavajecz (1999) and Sandas (2000). 4 4 we explore the e®ect of a change ... Narayan Naik, Maureen O'Hara, Christine Parlour, Patrik Sandas, Ilya Strebulaev, Avi Wohl, and seminar participants at Amsterdam, Emory, Illinois, Insead, Jerusalem, LBS, Tel Aviv, Wharton for ... ECNs). 1 A market order guarantees an immedi- ate execution at the best price available at the moment of the order arrival at the exchange. In general, a market order represents demand for liquidity

Ngày tải lên: 31/10/2014, 12:11

59 239 0
foucault, kadan and kandel-limit order book as a market for liquidity

foucault, kadan and kandel-limit order book as a market for liquidity

... Empirical analyses of limit order markets include Biais, Hillion and Spatt (1995), Handa and Schwartz (1996), Harris and Hasbrouck (1996), Kavajecz (1999), Sandås (2000), Hollifield, Miller and S and? ?s ... Suppose, for instance, that a common factor raises the order arrival rate and the proportion of patient traders Then the increase in the order arrival rate will not necessarily be associated ... who can strategically ch oose between market and limit orders. In fact we are not aware of any such dynamic models. 11 10 Harris and Hasbrouck (1996) and Harris (1998) also argue that optimal order

Ngày tải lên: 31/10/2014, 12:12

65 291 0
Food media food and technology as a medium for social communication

Food media food and technology as a medium for social communication

... Saadatian, Kasun Karunanayaka, , Shuang Yu, Haimo Zhang, Zhongyuan Zhang, Toni-Jan Keith Monserrat, Chen Chen, Soon Hau Chua, Yongfeng Huang, Xiaojun Meng, Chen Zhao, Marayam Azh, Rubaiat Habib ... filter and augment the appearance, verbal and nonverbal behavior of their avatars, such as the facial expression, gaze, and speech [9] By augmenting their representational, sensory, and ... others about their daily activities in an interactive way Basically, a communication process can occur on an instantaneous or a delayed basis, categorized into synchronous and asynchronous

Ngày tải lên: 10/09/2015, 09:02

263 304 0
Development of bordetella pertussis as a live vehicles for heterologous antigens delivery, and its application as a universal influenza a vaccine

Development of bordetella pertussis as a live vehicles for heterologous antigens delivery, and its application as a universal influenza a vaccine

... Kenneth and Yafang; friends in Associate Professor Fred Wang‟s lab and Associate Professor Herbert Schwarz‟s lab; as well as all those who have helped me in one way or another. I really appreciate ... spread of HPAI H5N1 virus across Asia and parts of Europe and the Middle East, as well as the occasional infections of humans with an overall... the nasal route offers several advantages ... responses are also achieved more easily by intranasal delivery However, although generally more effective than oral vaccination, intranasal vaccination usually... 5.1 Serum and BALFs anti-M2e

Ngày tải lên: 11/09/2015, 10:00

258 303 0
Intercultural performance as a paradigm for identity and discourse

Intercultural performance as a paradigm for identity and discourse

... intercultural Shakespeare is particularly useful as Asian Shakespeare performances can be placed alongside Shakespeare, and seen as a driving force that can enable the expansion of Shakespeare as a global ... various types of Asian and Western performance traditions and arts forms, and ignores internal contradictions prevalent in each performance culture and cultural history. Asian art forms when analyzed ... 1. 8 Asian performance forms and traditions used in performances this way may very well reduce Asian Shakespeare to an elaborate all-you-can-eat-Asian Exotica buffet with plenty of artificial flavoring

Ngày tải lên: 16/10/2015, 15:37

131 617 0
Assessment of capability, knowledge and skills of vocational school graduates a basis for enhanced industry academy cooperation

Assessment of capability, knowledge and skills of vocational school graduates a basis for enhanced industry academy cooperation

... knowledge and skill of vocational school graduates: A basis for enhanced industry-academe cooperation” as thesis topic for DBA course The research results will provide a basis for solutions for the ... cooperation Figure 2.5 A framework for analysing collaboration between enterprises and vocational training schools (The author has built up from practical and theoretical analyses) Curriculum Assessment ... After collecting the data using survey instruments, data are imported and cleaned Import and store data: Data are entered and stored on computer Excel spreadsheet software and SPSS statistical

Ngày tải lên: 09/05/2016, 16:41

23 200 0
Assessment of capability, knowledge and skills of vocational school graduates a basis for enhanced industry   academe cooperation

Assessment of capability, knowledge and skills of vocational school graduates a basis for enhanced industry academe cooperation

... variances not assumed Equal variances assumed Equal variances not assumed Equal variances assumed Equal variances not assumed Equal variances assumed Equal variances not assumed Equal variances assumed ... knowledge and skills of Equal variances not graduates assumed Electrical professional Equal variances assumed knowledge and skills of Equal variances not graduates assumed Equal variances assumed ... Samples Test df Equal variances assumed Attitude and competence of Equal variances not graduates assumed Equal variances assumed General knowledge of Equal variances not graduates assumed Equal

Ngày tải lên: 20/09/2017, 16:54

211 95 0
DSpace at VNU: Possibility of using a lithotrophic iron-oxidizing microbial fuel cell as a biosensor for detecting iron and manganese in water samples

DSpace at VNU: Possibility of using a lithotrophic iron-oxidizing microbial fuel cell as a biosensor for detecting iron and manganese in water samples

... poly-acrylic parts when the reactor was assembled A cm  cm Naon 117 membrane (Du Pont, USA) was used to separate the two compartments of each reactor Each reactor was assembled using nuts and ... anode and the cathode of each MFC Electrical parameters (current I (A) , voltage U (V), charge Q (C) and resistance R (U)) were measured and/ or calculated according to Aelterman et al (2006) and ... investigate (i) whether the LIO-MFCs can be used as biosensors for monitoring iron and manganese in water samples and (ii) factors that may a? ??ect their performance Materials and methods The lithotrophic

Ngày tải lên: 16/12/2017, 11:35

10 159 0
Social factors as a basis for treatment

Social factors as a basis for treatment

... therefore, which clubhouse elements are effective and which standards are necessary for success 175 Social factors as a basis for treatment Conclusion Social factors can affect the course and ... increased demand for inpatient psychiatric care (Abas et al., 2003), and, while poverty and substance abuse are not necessarily related, poverty often increases the degree of harm that occurs at any ... Psychiatry: An Update, Florence, Italy.) Gegenava, M and Kavtaradze, G (2006) Risk factors for coronary heart disease in patients with schizophrenia Georgian Medical News, 134, 55–8 Gold, M and Marrone,...

Ngày tải lên: 01/11/2013, 09:20

16 524 0
Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

... [27,60,61] TLR ligands have been implicated by other groups as a cause of CIJD or as enhancing factors in the disease, for example hypomethylated bacterial DNA [12], LPS [13] and heat shock protein ... other than chronic inflammatory disorders, for example cancer Competing interests None declared Acknowledgements We thank Reina Brehm for expert technical assistance and Marina Freudenberg for providing ... TLR-2-/- and TLR-4def mice We also thank Thomas Boehm for valuable suggestions and for reading the manuscript critically This work was supported in part by the Deutsche Forschungsgemeinschaft (Si...

Ngày tải lên: 09/08/2014, 01:23

14 506 0
w