acn charts 4 a and 4 b

Tài liệu REPORT OF THE STAFFS OF THE CFTC AND SEC TO THE JOINT ADVISORY COMMITTEE ON EMERGING REGULATORY ISSUES doc

Tài liệu REPORT OF THE STAFFS OF THE CFTC AND SEC TO THE JOINT ADVISORY COMMITTEE ON EMERGING REGULATORY ISSUES doc

... 14:< /b> 58 14:< /b> 56 14:< /b> 54 < /b> 14:< /b> 52 14:< /b> 50 14:< /b> 48 14:< /b> 46 14:< /b> 44 < /b> 14:< /b> 42 14:< /b> 40 14:< /b> 38 14:< /b> 36 14:< /b> 34 < /b> 14:< /b> 32 14:< /b> 30 14:< /b> 28 14:< /b> 26 14:< /b> 24 < /b> 14:< /b> 22 14:< /b> 20 14:< /b> 18 14:< /b> 16 14:< /b> 14 < /b> 14:< /b> 12 14:< /b> 10 14:< /b> 08 14:< /b> 06 14:< /b> 04 < /b> 14:< /b> 02 14:< /b> 00 Fraction of Buy-Side ... 14:< /b> 53 14:< /b> 52 14:< /b> 51 14:< /b> 50 14:< /b> 49 14:< /b> 48 14:< /b> 47 14:< /b> 46 14:< /b> 45 14:< /b> 44 < /b> 14:< /b> 43 14:< /b> 42 14:< /b> 41 14:< /b> 40 14:< /b> 39 14:< /b> 38 14:< /b> 37 14:< /b> 36 14:< /b> 35 14:< /b> 34 < /b> 14:< /b> 33 14:< /b> 32 14:< /b> 31 0% 14:< /b> 30 Fraction of Buy-Side Market Depth Relative to ... 14:< /b> 48 14:< /b> 46 14:< /b> 44 < /b> 14:< /b> 42 14:< /b> 40 14:< /b> 38 14:< /b> 36 14:< /b> 34 < /b> 14:< /b> 32 14:< /b> 30 14:< /b> 28 14:< /b> 26 14:< /b> 24 < /b> 14:< /b> 22 14:< /b> 20 14:< /b> 18 14:< /b> 16 14:< /b> 14 < /b> 14:< /b> 12 14:< /b> 10 14:< /b> 08 14:< /b> 06 14:< /b> 04 < /b> 14:< /b> 02 14:< /b> 00 Volume (contracts per minute) 80,000 Ma y...

Ngày tải lên: 19/02/2014, 03:20

104 989 0
Báo cáo khoa học: Crystal structures of the human SUMO-2 protein at 1.6 A and 1.2 A resolution ppt

Báo cáo khoa học: Crystal structures of the human SUMO-2 protein at 1.6 A and 1.2 A resolution ppt

... PCR was carried out for 25 cycles of 30 s at 95 °C, 30 s at 55 °C and < /b> 30 s at 72 °C, using two primers 5¢-GGAATTCCATATGGGAGTCAAGACTGAGAA CAAC-3¢ and < /b> 5¢-CCGCTCGAGTCAACCTCCCGTCT G-3¢ The DNA products ... of a < /b> half-open b- barrel and < /b> two flanking a-< /b> helices, with secondary structure elements arranged as bbabbab in the sequence (Fig 1), identical to those of ubiquitin, SMT3 and < /b> SUMO-1 Fig 3B shows a < /b> ... kDa JumbosepTM membrane (Pall Corporation, MI) Ó FEBS 20 04 < /b> 4116 W.-C Huang et al (Eur J Biochem 271) Crystallization and < /b> data collection Crystallization was achieved by the hanging-drop vapour...

Ngày tải lên: 16/03/2014, 18:20

9 442 0
Tài liệu hướng dẫn sử dụng Micrologic control units 2.0 A, 5.0 A, 6.0 A and 7.0 A pps

Tài liệu hướng dẫn sử dụng Micrologic control units 2.0 A, 5.0 A, 6.0 A and 7.0 A pps

... technical appendix "Digital display" Changing the control-unit battery Remove the battery cover E5 144< /b> 2A < /b> E5 144< /b> 3A < /b> Remove the battery 100 % 40< /b> % Insert a < /b> new battery Check the polarity Put the cover back ... back in place Press the batterytest button to check the new battery E5 144< /b> 5A < /b> E5 144< /b> 4A < /b> If the battery needs to be changed, please use the one with Schneider catalogue number 33593 (characteristics ... the battery compartment cover) + 100 % 40< /b> % 16 Micrologic A < /b> Schneider Electric Testing the earth-fault and < /b> earthleakage functions E5 145< /b> 6A < /b> E5 141< /b> 0A < /b> Charge and < /b> close the circuit breaker Using a < /b> screwdriver,...

Ngày tải lên: 05/07/2014, 10:20

31 3,3K 19
Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 6

Affinity guided isolation, structure elucidation and total synthesis of laetirobin a and its analogue synthesis for therapeutic development 6

... I 346< /b> Appendix Low-Resolution-Mass Data 3-2 C22H19IO7S2 586 .4 < /b> TsO O OTs I 347< /b> OBn 3-3 C13H12O 1 84.< /b> 2 348< /b> Appendix TsO O OTs 3- 24 < /b> C57H48O15S4 1101.2 OBn OTs O OTs Low-Resolution-Mass Data 349< /b> HO ... 3 -4 < /b> C29H24O7 48< /b> 4.5 OBn OH O OH 350 Appendix Low-Resolution-Mass Data O 3-5 C29H24O7 48< /b> 4.5 OH HO O OBn O O 351 HO O HO O O O 2-1 C44H32O12 752.7 O O HO O O OH 352 Appendix HO O HO O O O 3-26 C44H32O12 ... Low-Resolution-Mass Data 353 OH O 5-2 C18H14O3 278.3 O 3 54 < /b> Appendix Low-Resolution-Mass Data 355 O 5 -4 < /b> C36H24O4 520.6 O O O O O 5-6 C36H24O4 520.6 O O 356 Appendix Low-Resolution-Mass Data I OH 5-8...

Ngày tải lên: 10/09/2015, 15:50

34 228 0
Test yourself A and Test 1(Kiều Tính)

Test yourself A and Test 1(Kiều Tính)

... snowboarding, skydiving, hang-gliding, rock climbing, backpacking, and < /b> adventure tourism Some recreational activities are made illegal such as gambling and < /b> drug use Research has shown that recreation ... contributes to life satisfaction, quality of life, health and < /b> wellness, and < /b> that the use of recreation as a < /b> diversion may have clinical applications to individuals with chronic pain and < /b> other health ... choosing a < /b> wife or a < /b> husband A < /b> of B on C in D with He left the gas on, ? A < /b> didn’t he B had he C was he D wasn’t he Michael took a < /b> photograph of Sandra while she A < /b> smiled B was smiling C had...

Ngày tải lên: 02/07/2013, 01:25

5 719 1
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

... ACATGCTCCGAGA-3¢ and < /b> 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; collagen I: TCCTGGCAATCGTGGTT CAA and < /b> ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and < /b> GAAGGCCAG 3696 CTGTACATCAAGGA; alpha smooth muscle actin ... actin (a-< /b> SMA): AGCCAGTCGCCATCAGGAAC and < /b> CCGG AGCCATTGTCACACAC; and < /b> glyceraldehyde-3-phosphate dehydrogenase: 5¢-GGCACAGTCAAGGCTGAGAATG-3¢ and < /b> 5¢-ATGGTGGTGAAGACGCCAGTA-3¢ Immunocytochemical staining ... are as follows: IL- 1b: 5¢-GCTGTGGCAGCTACCTATGTCTTG-3¢ and < /b> 5¢-AGGTCGTCATCATCCCACGAG-3¢; TNF -a:< /b> 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and < /b> 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5¢-CAGACCC ACATGCTCCGAGA-3¢...

Ngày tải lên: 18/02/2014, 04:20

11 653 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

... 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs ... degradation [43< /b> ,44< /b> ] or that can be exploited for this purpose (expansins [45< /b> ]; see also [46< /b> ]) exist Materials and < /b> methods Bacterial strains and < /b> plasmids and < /b> cultivation Lactococcus lactis ssp lactis ... to as LlCBP3 3A)< /b> ; and < /b> a < /b> family 20 N-acetylhexosaminidase (LnbA) The chiA and < /b> yucG genes are separated by 19 bp in an operon starting with a < /b> putative transcriptional regulator positioned 166 bp...

Ngày tải lên: 18/02/2014, 08:20

14 683 0
Tài liệu Báo cáo khóa học: Suppression of b1,3galactosyltransferase b3Gal-T5 in cancer cells reduces sialyl-Lewis a and enhances poly N-acetyllactosamines and sialyl-Lewis x on O-glycans Lydia Mare and Marco Trinchera pdf

Tài liệu Báo cáo khóa học: Suppression of b1,3galactosyltransferase b3Gal-T5 in cancer cells reduces sialyl-Lewis a and enhances poly N-acetyllactosamines and sialyl-Lewis x on O-glycans Lydia Mare and Marco Trinchera pdf

... Galb1-4GlcNAcb1-3Gal NeuAca2-3Galb1-4GlcNAcb1-3Gal NeuAca2-3Galb1 -4[< /b> Fuca1-3]GlcNAcb1-3Gal NeuAca2-3Galb1-3GlcNAcb1-3Gal NeuAca2-3Galb1-3[Fuca1 -4]< /b> GlcNAcb1-3Gal Fig Secretion of Lewis antigens in ... b1 ,3galactosidases, giving rise to a < /b> disaccharide and < /b> a < /b> monosaccharide, and < /b> was thus identified as a < /b> mixture of Galb1 -4[< /b> Fuca1-3]GlcNAcb1-3Gal and < /b> Galb1-3[Fuca1 -4]< /b> GlcNAcb1-3Gal The calculated amounts ... gastrointestinal and < /b> pancreatic cells, counteracting the glycosylation pattern associated to malignancy We found in fact that NeuAca2-3Galb1-3[Fuca1 -4]< /b> GlcNAcb1-3Gal and < /b> NeuAca2-3Galb1-3GlcNAcb1-3Gal are...

Ngày tải lên: 19/02/2014, 12:20

9 461 0
Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx

Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx

... synthase subunit b: 5¢-CCTTCTGCTGTGGGCTATCA-3¢ and < /b> 5¢TCAAGTCATCAGCAGGCACA-3¢; ND5: 5¢-TAACCCC ACCCTACTAAACC-3¢ and < /b> 5¢-GATTATGGGCGTTGA TTAGTAG-3¢; b- globin: 5¢-CAACTTCATCCACGTTCA CC-3¢ and < /b> 5¢-ACACAACTGTGTTCACTAGC-3¢ ... 5¢-AAGACAGCAGCCCCAGTGAA-3¢ and < /b> 5¢-ACACCCAGCACCAGCACCT-3¢; PRC: 5¢-CACTGG TTGACCCTGTTCCT-3¢ and < /b> 5¢-GTGTTTCAGGGCTTC TCTGC-3¢; Cyt c: 5¢-CCAGTGCCACACCGTTGAA-3¢ and < /b> 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ATP ... quantification was performed by nonsaturating picture scanning by a < /b> gel Doc 1000 Molecular Analyst apparatus (Biorad) Respiratory parameters and < /b> respiratory ratio in intact cells Respiratory parameters and...

Ngày tải lên: 06/03/2014, 09:22

13 503 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... FnBPA-2, FnBPA-3, FnBPA -4,< /b> FnBPA-5, FnBPA-6, FnBPA-7, FnBPA-8, FnBPA-9, FnBPA-10, and < /b> FnBPA-11, and < /b> FnBPB-1, FnBPB-2 ⁄ 3, FnBPB -4,< /b> FnBPB-5, FnBPB-6, FnBPB-7, FnBPB-8, FnBPB-9, FnBPB-10, and < /b> FnBPB-11, ... -1 B Fn -2/3 BP Fn B -4 < /b> BP Fn B- 5 BP Fn B- 6 BP Fn BBP Fn B- 8 B Fn PBBP Fn B- 1 BP B1 1 0.0 D BR G A < /b> ST Fn BP Fn A-< /b> 1 BP Fn A-< /b> 2 BP Fn A-< /b> 3 BP Fn A < /b> -4 < /b> BP Fn A-< /b> 5 BP Fn A-< /b> 6 BP Fn A-< /b> 7 BP Fn A-< /b> 8 BP Fn ABP ... (pCU1::fnbA+ D9,10 Cmr) P1 P1 spa P1 fnbA fnbB P1 fnbA fnbB spa Wild type spa::Kanr fnbA::Tetr fnbB::Ermr spa::Kanr fnbA::Tetr fnbB::Ermr P1 fnbA fnbB spa (pCU1 fnbA+) spa::Kanr fnbA::Tetr fnbB::Ermr...

Ngày tải lên: 06/03/2014, 22:21

16 561 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

... distorted chair The C-terminal a-< /b> domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and < /b> human are available and < /b> revealed ... > I +4)< /b> of Zn4aMT and < /b> Zn3bMT with those observed for Cd7MT [20] Presence (+) or absence (–) of NOEs is indicated b- Domain Proton Asn (a)< /b> Asn (a)< /b> Asn (b) Cys (a)< /b> Cys (b) Asn 23 (b) a-< /b> Domain Lys ... (Tubingen, Germany), and < /b> all ¨ other chemicals were from Merck (Darmstadt, Germany) Synthesis of the individual a-< /b> and < /b> b- domains The individual a-< /b> and < /b> b- domains (KSCCSCCPVGCSKCA QGCVCKGAADKCTCCA...

Ngày tải lên: 07/03/2014, 09:20

14 485 0
Báo cáo khoa học: Puroindoline-a and a1-purothionin form ion channels in giant liposomes but exert different toxic actions on murine cells pptx

Báo cáo khoa học: Puroindoline-a and a1-purothionin form ion channels in giant liposomes but exert different toxic actions on murine cells pptx

... the binding, insertion and < /b> destabilization of phospholipid bilayer membranes by alpha-helical antimicrobial and < /b> cell non-selective membrane-lytic peptides Biochim Biophys Acta 146< /b> 2, 55–70 20 Betz ... digitized, at a < /b> sampling rate of 25 kHz, with the aid of a < /b> computer equipped with an analogue-to-digital interface board (DT 2821; Data Translation, Marlboro, MA, USA) Computerized data acquisition and < /b> ... large membrane blebs (arrows), and < /b> the increase in projected area of the cells Cells imaged before (Ac) and < /b> after (Ad) exposure to 10 lM a1< /b> -PTH in a < /b> Ca2+-free medium Note the absence of blebbing,...

Ngày tải lên: 07/03/2014, 12:20

13 436 0
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

... (3) and < /b> (4)< /b> , the dissociation rate constant, k, and < /b> the O2 affinity, K, can be derived for both the a < /b> and < /b> b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association ... oxygenation parameters in the salt-free buffers (Table 1, Average) can be considered as follows The BR rate constant for the a < /b> subunits within triliganded HbA and < /b> the BR quantum yield for the a < /b> subunits ... ! ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À a;< /b> bO2 ÞðaO2 ; bO2 Þ þ O2 ka À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! hv ð1Þ ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À ðaO2 ; b ðaO2 ; bO2 Þ þ O2 ! kb À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! where (aO2,...

Ngày tải lên: 16/03/2014, 14:20

11 577 0
Báo cáo khoa học: Cytosolic phospholipase A2-a and cyclooxygenase-2 localize to intracellular membranes of EA.hy.926 endothelial cells that are distinct from the endoplasmic reticulum and the Golgi apparatus pdf

Báo cáo khoa học: Cytosolic phospholipase A2-a and cyclooxygenase-2 localize to intracellular membranes of EA.hy.926 endothelial cells that are distinct from the endoplasmic reticulum and the Golgi apparatus pdf

... serum and < /b> incubated with goat polyclonal anti-cPLA2 -a < /b> and < /b> rabbit polyclonal anti-calreticulin sera, followed by donkey FITC-conjugated anti-sheep and < /b> donkey Texas Red-conjugated anti-rabbit sera ... antigen established by hybridization Proc Natl Acad Sci USA 80, 37 34< /b> 3737 31 Grewal S, Ponnambalam S & Walker JH (2003) Association of cPLA2-alpha and < /b> COX-1 with the Golgi apparatus of A < /b> 549< /b> human lung ... cPLA2 -a < /b> localization in endothelial cells 40< /b> 41< /b> 42< /b> 43< /b> 44< /b> 45< /b> 46< /b> 47< /b> 48< /b> 49< /b> 50 51 lipocortin on arachidonic acid release and < /b> proliferation in the A < /b> 549< /b> cell line: identification of E-Q-E-Y-V as a < /b> crucial...

Ngày tải lên: 16/03/2014, 18:20

13 388 0
.Get More and Do More at Dummies.com ®Start with FREE Cheat SheetsCheat Sheets include • Checklists • Charts • Common Instructions • And Other Good Stuff!To access the Cheat Sheet created specifically for this book, go towww.dummies.com/cheatsheet/e pptx

.Get More and Do More at Dummies.com ®Start with FREE Cheat SheetsCheat Sheets include • Checklists • Charts • Common Instructions • And Other Good Stuff!To access the Cheat Sheet created specifically for this book, go towww.dummies.com/cheatsheet/e pptx

... dribs and < /b> drabs and < /b> don’t want to have to pay for each trade you make although a < /b> number of brokerage houses, including Charles Schwab, TD Ameritrade, and < /b> Fidelity, allow customers to trade ... financial calculator, is also an accomplished writer who helps readers understand and < /b> make wise choices about their money His articles have appeared in many national publications, including AARP ... What the heck is “substantially identical” anyway? 293 As always, consider cost 2 94 < /b> Revamping Your Portfolio with Life Changes: Marriage, Divorce, and < /b> Babies 2 94 < /b> Betsy and < /b> Mark:...

Ngày tải lên: 16/03/2014, 21:20

387 2K 0
The a and b adapters are used as priming sites for both amplification

The a and b adapters are used as priming sites for both amplification

... the wells not allow more than one ssDNA bead to be loaded into a < /b> well • Enzyme beads and < /b> packing beads are added Enzyme beads containing sulfurase and < /b> luciferase, and < /b> packing beads used only ... are broken, and < /b> the beads are released • Enrichment beads are added (containing biotin); these attach to DNA rich beads only • A < /b> magnetic field filters all DNA rich beads from empty beads, and < /b> ... The B adapter contains a < /b> 5’ biotin tag used for mobilization • The beads are magnetized and < /b> attract the biotin in the B adaptors Filtering the Mess • There are four adaptor combinations that are...

Ngày tải lên: 19/03/2014, 22:32

19 390 0
Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from flax – linolipins A and B docx

Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from flax – linolipins A and B docx

... Arabidopsis thaliana J Biol Chem 276, 12832–12838 42< /b> Hisamatsu Y, Goto N, Hasegawa K & Shigemori H (2003) Arabidopsides A < /b> and < /b> B, two new oxylipins from Arabidopsis thaliana Tetrahedron Lett 44< /b> , ... mass spectral data This work was supported in part by Grant 09- 04-< /b> 01023 -a < /b> from the Russian Foundation for Basic Research and < /b> a < /b> grant from the Russian Academy of Sciences (program ‘Molecular and < /b> ... 801 .47< /b> 65 Fig Linolipin (EDE) content of flax leaves Galactolipids were separated and < /b> purified as described in Materials and < /b> methods EDE content was measured by UV absorbance of MGDG and < /b> DGDG fractions...

Ngày tải lên: 23/03/2014, 05:22

10 387 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

... (Hsp9 0a,< /b> forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp9 0b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... RodriguezPena JM, Francois J, Nombela C & Arroyo J (20 04)< /b> 44< /b> 62 34 < /b> 35 36 37 38 39 40< /b> 41< /b> 42< /b> 43< /b> 44< /b> 45< /b> The global transcriptional response to transient cell wall damage in Saccharomyces cerevisiae and < /b> its ... and < /b> Hsp90 inhibitor sensitivity in such strains; analysis that showed that many mammalian clients are able to be activated by both Hsp9 0a < /b> and < /b> Hsp9 0b Whether Hsp9 0a < /b> or Hsp9 0b is expressed in 44< /b> 54...

Ngày tải lên: 23/03/2014, 07:20

11 427 0
Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt

Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt

... Switzerland), CoomassieÒ brilliant blue R250 was obtained from Serva (Heidelberg, Germany), and < /b> disodium tetraborate decahydrate was obtained from Merck (Darmstadt, Germany) Sequencing grade modified ... in Arabidopsis thaliana Plant Physiol 108, 1505–1517 Oosawa N, Masuda T, Awai K, Fusada N, Shimada H, Ohta H & Takamiya K (2000) Identification and < /b> lightinduced expression of a < /b> novel gene of NADPH-protochlorophyllide ... masslynx version 4.< /b> 1 (Waters Corporation) With standard solvents, a < /b> capillary voltage of 3000 V and < /b> a < /b> cone voltage of 45< /b> V was used With neutral solvents, a < /b> capillary voltage of 3500 V and < /b> a...

Ngày tải lên: 30/03/2014, 02:20

8 362 0
w