a web application for drawing graphs networks

Building Web Applications with SVG ppt

Building Web Applications with SVG ppt

... applications  SVG is suitable for incorporation with HTML5, web- based applications, and rich Internet applications (RIAs) The last 10 years have seen a great elevation of the status of the phrase web- based ... subliminal sense of “atmosphere.” For browsers that support SMIL animation, some of these effects, including rotation, are animated Example 13: A Web Application for Drawing Graphs (Networks) This particular ... commonplace (or the 100-megapixel cameras that can be had for a small fortune), increasing the zoom factor much beyond screen resolution will cause pixelation Scalability is a tremendous advantage for...

Ngày tải lên: 29/03/2014, 14:20

293 2,3K 0
Analyse criterias when there is an m and a and take a company that you know as an example to analyse your criterias analyses

Analyse criterias when there is an m and a and take a company that you know as an example to analyse your criterias analyses

... opportunities for both Microsoft and their partners • Nokia brings proven capability and talent in critical areas • Ongoing share growth and the synergies across marketing, branding, and advertising Nokia ... employees informed on the regular basis on the combination Geography • • • • Affect adverse selection and moral hazard problems in M &A Hinder acquisitions’ efforts to assess the true value Hamper acquisitions’ ... Hungry for Information Curious, open to new ideas Quite ambitious Geography Nokia is selling its headquarters in Finland for 170 Microsoft Corporation is an American multinational corporation...

Ngày tải lên: 08/05/2014, 17:42

17 724 8
Personal Branding: The Ultimate Path To Fame, Wealth And Success

Personal Branding: The Ultimate Path To Fame, Wealth And Success

... ZELDMAN ANDY BUDD TIM VAN DAMME CHRIS SPOONER JASON SANTA MARIA CAMERON MOLL RYAN CARSON ANDY CLARKE PERSONAL BRANDING // The Ultimate Path to Fame, Wealth and Success THE ELEMENTS OF A PERSONAL ... SPOONER JASON SANTA MARIA CAMERON MOLL RYAN CARSON ANDY CLARKE PERSONAL BRANDING // The Ultimate Path to Fame, Wealth and Success WEB CELEBS (OH NOES!) John O’Nolan // WDC2010 PERSONAL BRANDING ... com PERSONAL BRANDING // The Ultimate Path to Fame, Wealth and Success John O’Nolan // WDC2010 PERSONAL BRANDING A SEMI-EDUCATIONAL EXPERIENCE EXAMINING THE ULTIMATE PATH TO FAME, WEALTH AND SUCCESS...

Ngày tải lên: 21/07/2014, 12:00

52 345 0
Báo cáo toán học: "Long path lemma concerning connectivity and independence number" pdf

Báo cáo toán học: "Long path lemma concerning connectivity and independence number" pdf

... u and v Also, for a vertex v and a set of vertices or subgraph A, define a (v, A) k-fan to be a set of k paths from v to A which are all pairwise vertex disjoint except at v All other standard ... Lesniak Graphs & Digraphs Chapman & Hall/CRC, Boca Raton, FL, fourth edition, 2005 [2] V Chv´tal and P Erd˝s, A note on Hamiltonian circuits, Discrete Math 2, (1972) a o 111-113 [3] J.L Fouquet and ... paths, meaning that each path contains exactly one vertex of B and one vertex of P This means that there must exist a pair of these paths, say P1 = p1 b1 and P2 = p2 b2 for pi ∈ V (P ) and...

Ngày tải lên: 08/08/2014, 14:23

7 172 0
Báo cáo y học: "Human rheumatoid arthritis tissue production of IL-17A drives matrix and cartilage degradation: synergy with tumour necrosis factor-α, Oncostatin M and response to biologic therapies" ppt

Báo cáo y học: "Human rheumatoid arthritis tissue production of IL-17A drives matrix and cartilage degradation: synergy with tumour necrosis factor-α, Oncostatin M and response to biologic therapies" ppt

... Sato K, Suematsu A, Okamoto K, Yamaguchi A, Morishita Y, Kadono Y, Tanaka S, Kodama T, Akira S, Iwakura Y, Cua DJ, Takayanagi H: Th17 functions as an osteoclastogenic helper T cell subset that ... stored at -80°C until used for biomarker analysis, and samples were available for this study at baseline and three months Clinical evaluation at each assessment was performed using the DAS28, and ... their baseline assessment of disease activity Patients were evaluated before and at 1, and 12 months after initiation of biologic therapy Blood samples were obtained and sera was separated and stored...

Ngày tải lên: 09/08/2014, 14:22

12 262 0
báo cáo khoa học: " Epigenetics of renal cell carcinoma: the path towards new diagnostics and therapeutics" pps

báo cáo khoa học: " Epigenetics of renal cell carcinoma: the path towards new diagnostics and therapeutics" pps

... Urakami S, Shiina H, Enokida H, Hirata H, Kawamoto K, Kawakami T, Kikuno N, Tanaka Y, Majid S, Nakagawa M, Igawa M, Dahiya R: Wnt antagonist family genes as biomarkers for diagnosis, staging, and ... 108 Majid S, Dar AA, Ahmad AE, Hirata H, Kawakami K, Shahryari V, Saini S, Tanaka Y, Dahiya AV, Khatri G, Dahiya R: BTG3 tumor suppressor gene promoter demethylation, histone modification and ... 101 Breault JE, Shiina H, Igawa M, Ribeiro-Filho LA, Deguchi M, Enokida H, Urakami S, Terashima M, Nakagawa M, Kane CJ, Carroll PR, Dahiya R: Methylation of the gamma-catenin gene is associated...

Ngày tải lên: 11/08/2014, 12:20

10 459 0
Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt

Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt

... Italy tomato strain (X85114), Idaho strain [15](USA, AF023877) and two Russian PVM isolates [2](D14449, Table 2) Primers PVM1 (Reverse: CTTCATTTGTTATTCGACTT) and PVM2 (Forward: ATGGGAGATTCAACRAAGAA) ... [11] A reaction containing no cDNA template was included in all PCR tests as a blank control The temperature regime for amplification reactions was as follows: initial denaturation for at 95°C, ... Ruiz de Galarreta JI, Carrasco A, Salazar A, Barrena I, Iturritxa E, Marquinez R, Legorburu FJ, Ritter E: Wild Solanum species as resistance against different pathogens of potato Potato Res 1998,...

Ngày tải lên: 12/08/2014, 04:21

7 452 0
i''m and they''re, won''t and don''t

i''m and they''re, won''t and don''t

... ords Are Categorical books ® But and For, Yet and Nor: What Is a Conjunction? Dearly, Nearly, Insincerely: What Is an Adverb? Hairy, Scary, Ordinary: What Is an Adjective? How Much Can a Bare Bear ... Cleveland, Ohio Brian Gable is the illustrator of many Words Are CATegorical® books and the Math Is CATegorical® series Mr Gable also works as a political cartoonist for the Globe and Mail newspaper ... Cleveland, Ohio BRIAN GABLE is the illustrator of many Words Are CATegorical® books and the Math Is CATegorical® series Mr Gable also works as a political cartoonist for the Globe and Mail newspaper...

Ngày tải lên: 14/11/2014, 08:45

36 430 0
Path integrals in physics, vol 2  QFT, statistical physics and modern applications   chaichian m , demichev a

Path integrals in physics, vol 2 QFT, statistical physics and modern applications chaichian m , demichev a

... operator approach, we have to deal anyway with functionals, so that an application of path (functional) integrals in this area is highly natural Path integrals in scalar eld theory In fact, ... H A( S) (a , a) ei(t1t2 ) H A( S) (a , a) ei(t2 t0 ) H |a0 = da da1 db db1 da da2 db da2 a| ei(t t1) H |a1 ea ì a1 | A( S) (a , a) |b1 eb ì a2 | A( S) (a , a) |b2 eb b1 b1 |ei(t1 t2 ) H |a2 ea ... Hamiltonians of physical systems, thus (3.1.153) is a formal analog of the transition from the Lagrangian to the 36 Quantum eld theory: the path-integral approach Hamiltonian formalism in classical...

Ngày tải lên: 17/03/2014, 14:31

355 445 0
The effects of clay a m e n d m e n t and composting on metal speciation in digested sludge liang qiao

The effects of clay a m e n d m e n t and composting on metal speciation in digested sludge liang qiao

... Ni, but the plant available Pb was dramatically decreased The finding is similar to that of Garcia et al ,(1990) who extracted more plant available metals by DTPA after composting of aerobic digested ... mobility and plant availability of Pb were significantly reduced, because the leachability and plant availability of metals can be expressed as the exchangeable, carbonates and oxides bound metal species ... released into the environment (iii) Leachable metal as measured by 0.01 M CaC12 extraction and plant available metal as measured by 0.1 M DTPA extraction are related to the metal in exchangeable...

Ngày tải lên: 23/09/2012, 14:47

14 1K 0
Báo cáo y học: " Induction and effector phase of allergic lung inflammation is independent of CCL21/CCL19 and LT-beta

Báo cáo y học: " Induction and effector phase of allergic lung inflammation is independent of CCL21/CCL19 and LT-beta

... by real-time PCR analysis of RNA for IL-2, IL-4, IFNγ, and HPRT, and calculating the IL-4/IFNγ ratios Intranasal challenge was performed on day 14, 15 and 16 (days 0, 1, and after transfer) as ... then incubated for 30 on ice under constant agitation with magnetic beads coated with a sheep anti-rat IgG covalently linked Abs (Dynabeads M-450, Dynal, Oslo, Norway) at a bead to cell ratio of ... the mutant mice, as dramatic peribronchial and perivascular infiltration was produced in all mice (Figure 2) Airway reactivity measurements Airway hyper-responsiveness (AHR) to metacholine (Acetyl-β...

Ngày tải lên: 03/11/2012, 11:24

8 622 0
CONSTRUCTION PROJECT ACTIVITIES AND M&E WORK

CONSTRUCTION PROJECT ACTIVITIES AND M&E WORK

... predictors and the quality performance measures as a set of criterion variables 5.5.1 Basic concepts of Factor Analysis (FA) and Canonical Correlation Analysis (CCA) Factor analysis 29 Factor analysis ... created for each factor in the final solution regression method and used as input data for further canonical analysis 6.4 Data analysis with CCA 6.4.1 Canonical model, assumption and data examining ... standardized scores (z scores) are computed as a part of SPSS Descriptive procedure and they are added to the data in the Data Editor and are available for SPSS charts, data listings, and analyses...

Ngày tải lên: 13/04/2013, 10:33

73 603 3
Chương 10 vector Mask - path and shapes trong photoshop

Chương 10 vector Mask - path and shapes trong photoshop

... layer invitational chọn, sau vào Layer > Type > Create Work Path Trên palette Path ý Work path xuất bao gồm biểu tượng thu nhỏ văn “invitational” 2.Trong palette Layer chọn layer invitational ... invitational tới ph a dưói c a sổ hình, khối văn “the full moon proam” Chú ý đổi tên layer từ layer2 thành invitational palette Layer Đóng nhóm palette Character 7.Chọn File > Save Tạo Work Path ... dụng) · Cỡ font để cỡ 38 · Với leading để 28 3.Trong nhóm palette Character chọn tab Paragraph, sau chọn chế độ canh chỉnh Center Text Chú ý tuỳ chọn Character Paragraph thường sẵn có công cụ option...

Ngày tải lên: 03/07/2013, 21:51

37 751 4
AutoCAD and AutoCAD LT AIO desk reference   for dummies

AutoCAD and AutoCAD LT AIO desk reference for dummies

... format used by AutoCAD Release 14 as well as AutoCAD LT 97 and LT 98 Book I Chapter Drawing on (and in) AutoCAD AutoCAD is a backward-compatible program This doesn’t mean you can open drawings backward ... File Format AutoCAD 2007 AutoCAD LT 2007 2006 AutoCAD 2007 AutoCAD 2006 AutoCAD LT 2006 2005 AutoCAD 2004 AutoCAD 2005 AutoCAD LT 2005 2004 AutoCAD 2004 AutoCAD 2004 AutoCAD LT 2004 2003 AutoCAD ... Canada, and has been an AutoCAD consultant and trainer for fifteen years Dave is an AutoCAD Authorized Author, a contributing editor for Cadalyst magazine, and has been a contributing author to...

Ngày tải lên: 14/08/2013, 08:52

819 386 2
Heat transfer and friction factor characteristics using continuous M shape ribs turbulators at different orientation on absorber plate solar air heater

Heat transfer and friction factor characteristics using continuous M shape ribs turbulators at different orientation on absorber plate solar air heater

... has been published more than 40 papers in International / National Journals E-mail address: varun7go@gmail.com Manish Kumar Chauhan has been graduated in Mechanical Engineering in 2009 and after ... Aharwal K.R, Gandhi B.K, Saini J.S Heat transfer and friction characteristics of solar air heater duct having integral inclined discrete ribs on absorber plate International Journal of Heat and ... Heat Transfer His area of interest is Heat Transfer, Solar Energy, Refrigeration and Air Conditioning and Fluid Mechanics E-mail address: sachin.chaudhary309@gmail.com Varun has been graduated...

Ngày tải lên: 05/09/2013, 15:28

16 598 0
Kiểm tra GT 12 chuong I

Kiểm tra GT 12 chuong I

... ⇔  ⇔m<  ∆ = − 4m > m <  Câu (4 điểm) Tim giá tri lớn nhấ t, giá giá tri nhỏ nhấ t cu a các hàm số : ̣ ̣ ̀ a) y = x4 – 6x2 + các đoa ̣n [- , 1] TXĐ: D = R y’ = 4x3 – 12x y ' = ⇔ ... = 1,0 1,0 Số giao điể m cu a (C) và d chinh là số nghiêm cu a phương trinh ̣ ́ ̀ − x( x − 3x + m) = Đă ̣t g(x) = x − x + m + Để (C) và đường thẳ ng d: y = mx – cắ t ta ̣i điể m phân ... trinh tiế p tuyế n với (C) ta ̣i A( -1; 2) ̀ Ta có x0 = -1; y0 = 2 y '( x ) = −3 x0 + x0 = -3 -6 = -9 Phương trinh tiế p tuyế n với (C) ta ̣i A( -1; 2) có da ̣ng: y = y '( x ) (x - x0) +...

Ngày tải lên: 26/09/2013, 06:10

3 285 0
Tim m doi voi phuong trinh,bat phuong trinh va he bang pp don dieu va gtnn , gt

Tim m doi voi phuong trinh,bat phuong trinh va he bang pp don dieu va gtnn , gt

... nghiệm : g) g ( m) > ⇔ m > tan x + cot x + m(tan x + cot x ) + = Đặt t = tan x + cot x ⇒ t = tan x + cot x + Tìm điều kiện cho t : t = tan x +cot x = tan x + cot x ≥ tan x cot x ⇔t ≥ (vì Lúc : ... biến nên ta có f (1) < f ( x) < f (3) ⇔ < t < Nhận xét số nghiệm x thông qua t t t • Ta có x − x + = ⇔ ( x − 1) = − Suy ứng với giá trị t ∈(2,3) ta có giá trị x ∈(1,3) Lúc (2) suy ra: Xét hàm ... nghiệm với x ⇔ g ( m) ≥ max f ( x) ⇔ m ≥ 27 Bài 2: Tìm m để bất phương trình có nghiệm a) mx − x − ≤ m +1 b) sin x + 3cos x ≥ m.3sin x c) x −4 x +3 +2mx −6 > Bài làm : a) mx − x − ≤ m +1 Điều...

Ngày tải lên: 28/09/2013, 07:10

22 2,7K 24
w