... Preface IX Part Pathophysiology Anatomo-Pathological Aspects Chapter Macro and Microscopic Aspects Fernando Candanedo-Gonzalez, Leslie Camacho-Rebollar and Candelaria Cordova-Uscanga Chapter Phaechromocytoma ... phaeochromocytomas make up of about 50% of all phaeochromocytomas and are usually unilateral and unicentric while more than 50% of familial forms are bilateral and coexist with extraadrenal sympathetic and ... Families with Hereditary Pheochromocytoma 149 Shirin Hasani-Ranjbar, Azadeh Ebrahim-Habibi and Bagher Larijani Preface Cardiovascular diseases are the major cause of mortality in developed and...
Ngày tải lên: 27/06/2014, 17:20
... CGTCAACAGTCGCCTTCAGG GCCGATGGCATTGACATTG TACCGCACAACAAAAGGGA TCTTTTAGTTCCAGGAACCTG AAGAAGACCTGGGGCTGGA ATGTAGATGATGTAGTCGAC GTATCTCAAGGGATTCCCCA GAATTCTTCTATCAACGAGAGG CATCGGCAAAGCCCTGATC AGCAGAAGACGATTCAACGACG ... GACTCTCGAGATCAAGCAC TCTGATTGCGGCTGGTTTC GCAATTGAGAGCAGTTTCG TTGAAGAAGGAGCACGAATGCC AAGAGAAGAGATGGTGGTCC CTCTCACCATCAAAGCCAAAG TCATGTCTAAGAGCATAGGC TGTCCAGTTGCCCGAGTTGA CGGGCTATCTGATCCTCA CACCTCGTTCACTCATATCA ... AAGCAGTGGTATCAACGCAGAGT ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30N-1N GAAGATGTGCGTAATATTAGC GTCTTGTCTTTATACACCAGCC GGGAAATGGACTACTACGAG AGCCTGGTACGTAGATGCA ATTGAGCATTCCCGGCGA TTCTGCTGCTAGGGAAATAG GACTCTCGAGATCAAGCAC...
Ngày tải lên: 07/03/2014, 12:20
Đề tài " Existence and minimizing properties of retrograde orbits to the three-body problem with various choices of masses " potx
... Following a standard argument in the calculus of variations, the action functional A attains its infimum on Hφ Although it may appear as an easy fact, let us remark here that collision∗ free critical ... with a mixture of topological and symmetry constraints The advantage of our approach, as Figure indicates, is that it applies to a wide range of masses In sharp contrast with the results obtained ... solutions constructed by variational methods can totally discard this constraint A question for the variational approach, especially on planar problems, naturally arises: Are minimizing methods...
Ngày tải lên: 29/03/2014, 07:20
Economic Trajectories in Non-Traditional Families with Children doc
... Trajectories in Non-Traditional Families with Children Sarah O Meadows * RAND Corporation Sara S McLanahan Princeton University Jean T Knab Mathematica Policy Research August 21, 2009 * The Fragile ... biological father (separate variables) or stably non-coresidential (15.0%) for all five years There are also a set of transition dummy variables that categorize all the possible relationship changes ... portions of the model where data is available Based on missing data patterns, 113 mothers are missing at least one independent variable in the model for material hardship and 76 mothers are missing at...
Ngày tải lên: 30/03/2014, 14:20
Báo cáo sinh học: " Human umbilical cord blood-derived mononuclear cell transplantation: case series of 30 subjects with Hereditary Ataxia'''' docx
... duration at the time of treatment was 26 years Patients treated came from Australia, Britain, Canada, China, Chile, Italy, South Africa and U.S .A There were no significant demographic or baseline ... cases) and cases of FRDA The mean age was 43.14 ± 12.77 (range 19 to 71 years) The male-female gender ratio was 18:12 On average, patients had ataxias for 10.74 ± 5.89 years The longest disease ... Perlman S: Clinical features and molecular genetics of autosomal recessive cerebellar ataxias Lancet Neurol 2007, 6:245-257 Brusse E, Maat-Kievit JA, Swieten JC: Diagnosis and management of earlyand...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" Human umbilical cord blood-derived mononuclear cell transplantation: case series of 30 subjects with Hereditary Ataxia" pdf
... duration at the time of treatment was 26 years Patients treated came from Australia, Britain, Canada, China, Chile, Italy, South Africa and U.S .A There were no significant demographic or baseline ... cases) and cases of FRDA The mean age was 43.14 ± 12.77 (range 19 to 71 years) The male-female gender ratio was 18:12 On average, patients had ataxias for 10.74 ± 5.89 years The longest disease ... Perlman S: Clinical features and molecular genetics of autosomal recessive cerebellar ataxias Lancet Neurol 2007, 6:245-257 Brusse E, Maat-Kievit JA, Swieten JC: Diagnosis and management of earlyand...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo hóa học: " Moving Target Indication via Three-Antenna SAR with Simplified Fractional Fourier Transform" pdf
... processing algorithm, three-antenna DPCA stripmap SAR data from three point targets, one moving target and two stationary targets, are simulated using the parameters listed Wang EURASIP Journal on Advances ... fore and aft antennas But phase center offset and antenna deformation may cause decorrelation So, decorrelation analysis is necessary Suppose the clutter signals from the two DPCA antennas are represented ... considered as a generalized form of Fourier transform that corresponds to a rotation over an arbitrary angle a = a /2 with a ∈ , as shown in Figure The forward and inverse FrFT of x(t) are defined,...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo toán học: "Set families with a forbidden subposet" pptx
... want to embed P , and have already established the lemma for all smaller saturated posets Use the preceding lemma to obtain a leaf v and an interval I ∋ v such that P \ I is a still a saturated ... degree of G is at least 4|P | Since every graph of of average degree d contains a non-empty subgraph of minimum degree at least d/2, the graph G contains a subgraph G′ of minimum degree at least ... straightforward generalization of the two arguments above Proof of Theorem By an interval in a poset P we mean a set of the form [x, y] = {z ∈ P : x z y} A maximal chain in a poset P is a chain, which...
Ngày tải lên: 08/08/2014, 01:20
Báo cáo y học: "Successful C1 inhibitor short-term prophylaxis during redo mitral valve replacement in a patient with hereditary angioedema" ppt
... current state -of- theart review, VII: Canadian Hungarian 2007 International Consensus Algorithm for the Diagnosis, Therapy, and Management of Hereditary Angioedema Ann Allergy Asthma Immunol 2008, ... valve repair with resection of chordae tendineae, and closure of dehisced prior leaflet closure; removal of annuloplasty band and insertion of 32 CardioMedics annuloplasty ring; and intraoperative ... al Journal of Cardiothoracic Surgery 2010, 5:86 http://www.cardiothoracicsurgery.org/content/5/1/86 Page of Figure C1 INH action in plasma cascades Depletion of C1 INH due to plasma cascade activation...
Ngày tải lên: 10/08/2014, 09:22
báo cáo khoa học: "Complications of Evans'''' syndrome in an infant with hereditary spherocytosis: a case report" pdf
... clinical management of the patient, acquisition of data, drafting the manuscript; HI was supervisor of clinical management of the patient and interpretation of data; TY, TI, AM were responsible of ... IgG quantitative analysis showed mild elevation in the patient, we concluded that the infant with HS was accompanied by ITP and DAT negative AIHA (Evans' syndrome) At the age of 10 months after ... immunoradiometric assay Jap J transfusion Med 1992, 38:601-606 Kondo H, Kajii E, Oyamada T, Kasahara Y: Direct antiglobulin test negative autoimmune hemolytic anemia associated with autoimmune hepatitis...
Ngày tải lên: 10/08/2014, 22:20
Báo cáo y học: "Membranous nephropathy in a patient with hereditary angioedema: a case report" pps
... prophylaxis, attenuated androgens such as 17alpha-ethinyl testosterone (Danazol) and stanozolol potent androgens such as oxandrolone and antifibrinolytic agents such as tranexamic acid and epsilon aminocaproic ... may complicate the management of fluid overload states in these patients It may be difficult to distinguish between fluid overload and attacks of angioedema in patients with HAE and renal failure ... in managing renal impairment and nephrotic syndrome due to membranous nephropathy in a patient with HAE There are not much data on the effect of renal failure on HAE and, since angioedema causes...
Ngày tải lên: 11/08/2014, 21:22
báo cáo khoa học:"Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta" doc
... GGCATAGTAGCAGGCAACTGT R: ACAAAGTACATTGGAAACCTCACAA F: ATAGATCATAAGGCAGTTTAACATATT R: TAGAAAAGTAGCTGGAGAAGTATAATG F: CTCCATCTTTCCATTCCTACCCA R: GAGTAAAAATATTCCCTCATGTTGCT F: CTAAAGAATGATATGGATGCTCCTAAT ... GCCCTCTCAAGTGTATTTCTGACA F: GCAGCTTGAAAACTACCAGATGAT R: ACTTTGCCTCGATTTGAGAGTTTA F: CACTGGGAAGTTCTAAGGTT R: AACGGAGTTATCTAGATAAACAAG F: CAGCCTGAATCACAGCTCTATT R: TTAAAAGGCAACAGTATTTGGGTA F: TTATCATTATCGTCTTTGCCCTAT ... R: AATGAGAGTCGGTGGCGTGT F: GTAAATCAATCATTGATCTTG R: GCCATTTCTTTCTTTGAGGG F: GGTGCAGAGTTTTCGTAAAC R: AAATAAAGATAGATAGTAAAAAGG F: CATCTACAACCAGTAAAAACC R: GCAAAGCCAAGATTTCTTATG F: GGATTGGTTGTTACAGATGCC...
Ngày tải lên: 11/08/2014, 23:22
Báo cáo y học: " Hemodynamic and clinical onset in patients with hereditary pulmonary arterial hypertension and BMPR2 mutations" pot
... very young (age 22 years) because of PAH, no DNA sample was available She had dyspnoea from early childhood on and was initially diagnosed as bronchial asthma although no asthma attacks had occurred ... of PAH at an age of 33 years which was finally confirmed by right heart catheterization at age of 34 years (heart rate per min: 105; pulmonary arterial systolic pressure: 68 mmHg; pulmonary arterial ... for patients with familial PAH and hereditary hemorrhagic telangiectasia carrying a mutation in the ACVRL1 gene In our families hereditary hemorrhagic telangiectasia and ACVRL1 gene defects have...
Ngày tải lên: 12/08/2014, 13:22
Báo cáo y học: "ribriform-Morular Variant of Papillary Carcinoma: Association with Familial Adenomatous Polyposis Report of Three Cases and Review of Literature"
... mutation of the APC gene in a case of cribriformmorular variant of papillary thyroid carcinoma Am J Clin Pathol, 2001 115: 486-493 Yamashita T., et al Peculiar nuclear clearing composed of microfilaments ... clinical, pathological, and molecular genetics study Am J Pathol, 1999 154(1): 127-135 Fenton P .A. , et al Cibriform variant papillary thyroid cancer: a characteristic of familial adenomatous polyposis ... Bilateral mass Exon 15 at codon 698 F/24 Yes Bilateral mass F/51 Yes Bilateral mass Multifocal (3-35 mm) capsular and vascular + 20-35 mm, capsular invasion 6-23 mm et F/20 Yes Diagnosis made...
Ngày tải lên: 03/11/2012, 10:05
Time and performance a three part study examining the relationships of job experience, organizational tenure, and age with job performance
... Quiñones et al (1995) The manual search examined seven management journals—Academy of Management Journal, Administrative Science Quarterly, Industrial and Labor Relations Review, Journal of Management, ... 01-05 TABLE Meta -analysis of temporal variables and performance with covariates Covariate Set (Simple analysis) Intercept (1) Job Experience (ß )a 0.171** Temporal Variable (2) Organizational Tenure ... Analyses As this study examines a sample of employees over the span of their careers, and because the nature of this sample made organizational tenure and age nearly Page 25 Time and Performance...
Ngày tải lên: 11/09/2013, 11:44
A three phase voltage type PWM rectifier with the function of an active power filter
... term of the n -th harmonic component of i,, Though the AC components are also contained in the output signal of the integrator, they can be made small by the integral action of the integrator and ... sinusoidal waveform in compliance with the sinusoidal reference signal and , that the current i has a nearly rectangular waveform due to the existence of a smoothing reactor Fig3(b) shows the waveform ... KataokaT 1996, nt-type PWM rectifier with active filtering function", IEEJ SPC- 96 (107), 11-20 ( in Japanese) KataokaT, Murota 1, Fuse Y, Nakajima D and Nishikata S 1999, A Single-phase Voltage-Type...
Ngày tải lên: 03/01/2014, 19:44
Tài liệu ime Control of a Three Phase 4 Wire PWM Inverter with Variable DC Link Voltage and Battery Storage for PV Application doc
... 1, January 1991, pp 62-72 [2] Takao Kawabata, Takeshi Miyashita and Yushin Yamamoto, "Dead Beat Control of threePhase PWM Inverter", IEEE Transactions on Power Electronics, Vol 5, No 1, January ... that it does not affect the output voltage References [1] Takao Kawabata, Takeshi Miyashita and Yushin Yamamoto, "Digital Control of three-Phase Inverter with LC Filter", IEEE Transactions on Power ... controllable dc link volta as indica in the ri age ated ight hand sub b diagram d Figure capacitor v voltage of the output filt with unbalanced load and controlled DC lin ter d o nk vo oltage Figure...
Ngày tải lên: 19/01/2014, 02:20
Tài liệu Three Families of Lines docx
... and at a right angle to a level surface Horizontal lines are at a right angle to vertical lines, and are parallel to a level surface Diagonal lines are neither vertical nor horizontal, but rather, ... she was awarded a Certificate of Membership from “Forensic Artists International” Her home -based art career included graphic design, and teaching recreational drawing and painting classes As supervisor ... FAMILIES OF LINES Lines visually separate and/or define the forms, shapes, and patterns of the various components of a drawing Straight, angle, and curved lines are the basic building blocks of...
Ngày tải lên: 26/01/2014, 08:20
Tài liệu Báo cáo khoa học: Antioxidant defences in cybrids harboring mtDNA mutations associated with Leber’s hereditary optic neuropathy docx
... immunoreactivity was detected in the same way as described above Quantitative analysis of the blots was carried out using the image j software (http//rsb.info.nih.gov ⁄ ij ⁄ ) Statistical analysis ... Results are expressed as arithmetic means ± SD Comparisons were made by one-way analysis of variance A P value of less than 0.05 was considered significant Acknowledgements This work was supported, ... Mitochondria-mediated transformation of human rho (0) cells Methods Enzymol 264, 313–334 Carelli V, Rugolo M, Sgarbi G, Ghelli A, Zanna C, Baracca A, Lenaz G, Napoli E, Martinuzzi A & Solaini G (2004)...
Ngày tải lên: 19/02/2014, 16:20