a usa and b canada

LECTURES ON SHIMURA VARIETIES (A.GENESTIER AND B.C.NGO)

LECTURES ON SHIMURA VARIETIES (A.GENESTIER AND B.C.NGO)

... has a < /b> canonical realization as 35 Zariski open subset of a < /b> complex projective algebraic variety In particular, it has a < /b> canonical structure of complex algebraic variety These quotients Γ\X + as ... rational PE-structure (polarization and < /b> endomorphism) is a < /b> collection of data as follows (1) B is a < /b> finite-dimensional simple Q-algebra, assume that BQp is a < /b> product of matrix algebra over unramified ... a < /b> matrix algebra Now let k be an arbitrary field and < /b> k its algebraic closure Automorphism of a < /b> B- module is of the form GLm (F ) where F is the center of B, has trivial Galois cohomology This allows...

Ngày tải lên: 05/10/2014, 12:44

50 243 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

... 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs and < /b> annealed to a < /b> prepared ... Costs and < /b> benets of processivity in enzymatic degradation of recalcitrant polysaccharides Proc Natl Acad Sci USA < /b> 103, 1808918094 41 Tsujibo H, Orikoshi H, Baba N, Miyahara M, Miyamoto K, Yasuda M ... incubation FEBS Journal 276 (2009) 24022415 ê 2009 The Authors Journal compilation ê 2009 FEBS G Vaaje-Kolstad et al Degradation of a-< /b> and < /b> b- chitin The degradation rates of a-< /b> and < /b> b- chitin were assayed...

Ngày tải lên: 18/02/2014, 08:20

14 683 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

... distorted chair The C-terminal a-< /b> domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and < /b> human are available and < /b> revealed ... (Tubingen, Germany), and < /b> all ¨ other chemicals were from Merck (Darmstadt, Germany) Synthesis of the individual a-< /b> and < /b> b- domains The individual a-< /b> and < /b> b- domains (KSCCSCCPVGCSKCA QGCVCKGAADKCTCCA ... Zn4aMT and < /b> Zn3bMT with those observed for Cd7MT [20] Presence (+) or absence (–) of NOEs is indicated b- Domain Proton Asn (a)< /b> Asn (a)< /b> Asn (b) Cys (a)< /b> Cys (b) Asn 23 (b) a-< /b> Domain Lys (NH) Lys (a)< /b> ...

Ngày tải lên: 07/03/2014, 09:20

14 485 0
Báo cáo khóa học: Conformational changes of b-lactoglobulin in sodium bis(2-ethylhexyl) sulfosuccinate reverse micelles A fluorescence and CD study docx

Báo cáo khóa học: Conformational changes of b-lactoglobulin in sodium bis(2-ethylhexyl) sulfosuccinate reverse micelles A fluorescence and CD study docx

... basis Data analysis was performed by a < /b> deconvolution method using a < /b> nonlinear least-squares fit programme, based on the Marquardt algorithm The goodness of fit was evaluated by statistical parameters ... peptide bond absorption band causing no changes in the far-UV CD spectra So, the broad band centred at 270 nm obtained in bLG CD spectra upon encapsulation on AOT RM may arise from the changes in nature ... preparation Bovine bLG (AB mixture), chromatographically purified and < /b> lyophilized to ‡ 90% purity (Sigma; catalogue no L-3908), N-acetyltryptophanamide (NATA) (Sigma; catalogue no A-< /b> 6501) and < /b> AOT...

Ngày tải lên: 07/03/2014, 15:20

11 523 0
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

... NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thrc NeuAca2-6(3)Galb1-4GlcNAc-Rc Galb1-3GalNAca1-O-Ser/Thr Galb1-4GlcNAc-R Gala1-O-pNp GalNAca1-O-pNp GlcNAca1-O-pNp Galb1-4GlcNAcb-O-octyl Galb1-3GlcNAcb-O-octyl Galb1-3GalNAca1-O-bn ... gland, caudate nucleus, temporal lobe, hippocampus, and < /b> fetal tissues (brain, kidney, thymus, liver), and < /b> rather weakly in placenta, lung, aorta, amygdala, occipital and < /b> parietal lobe and < /b> salivary ... specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a < /b> HpaI site and < /b> Back 6I 5¢-CGATGGTACCGTACTTGTTCATGCTTAGG-3¢ and < /b> subcloned into pUC19 for further...

Ngày tải lên: 08/03/2014, 08:20

12 584 0
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

... (3) and < /b> (4), the dissociation rate constant, k, and < /b> the O2 affinity, K, can be derived for both the a < /b> and < /b> b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association ... oxygenation parameters in the salt-free buffers (Table 1, Average) can be considered as follows The BR rate constant for the a < /b> subunits within triliganded HbA and < /b> the BR quantum yield for the a < /b> subunits ... ! ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À a;< /b> bO2 ÞðaO2 ; bO2 Þ þ O2 ka À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! hv ð1Þ ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À ðaO2 ; b ðaO2 ; bO2 Þ þ O2 ! kb À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! where (aO2,...

Ngày tải lên: 16/03/2014, 14:20

11 577 0
Báo cáo khoa học: A (1fi3)-b-D-glucan recognition protein from the sponge Suberites domuncula Mediated activation of fibrinogen-like protein and epidermal growth factor gene expression pot

Báo cáo khoa học: A (1fi3)-b-D-glucan recognition protein from the sponge Suberites domuncula Mediated activation of fibrinogen-like protein and epidermal growth factor gene expression pot

... gambiae (ENSAN1_ANGA, XP_312118.1), (ENSAN5_ANGA, XP_312116.1) and < /b> (BACBP_ANGA, CAA04496.1), as well as the GLUBP from the lobster Homarus gammarus (GLUBP_HOGAM, CAE47485.1) and < /b> the crayfish Pacifastacus ... thio -b- Dgalactoside, the bacterial extract was isolated and < /b> purified by affinity chromatography (Fig 8A;< /b> lanes a < /b> and < /b> b) The 68 kDa recombinant fusion protein (r-EGF_SUBDO) was used to raise PoAbs, as described in ... epithelial layer formed from pinacocytes Magnifications: A-< /b> a and < /b> B -a,< /b> · 25; A-< /b> b and < /b> B- b, · 50; A-< /b> c and < /b> B- c, · 100 PoAb-EGF precursor, which corresponded to a < /b> molecular weight of kDa This molecular...

Ngày tải lên: 16/03/2014, 16:20

14 300 0
Báo cáo khoa học: A mitochondrial cytochrome b mutation causing severe respiratory chain enzyme deficiency in humans and yeast doc

Báo cáo khoa học: A mitochondrial cytochrome b mutation causing severe respiratory chain enzyme deficiency in humans and yeast doc

... chain subunits were unaffected (Fig 3A)< /b> BN-PAGE and < /b> in-gel activity assays further confirmed the A < /b> B Fig Quantitation of the relative amounts of mutant and < /b> wild-type mtDNA in patient tissues by ... probably acts as a < /b> backbone H-bond donor to Asn316 Mutation of Lys319 to a < /b> proline would remove this H-bond and < /b> probably be disruptive for the geometry of the turn Lys319 approaches with ˚ 4.5 A < /b> ... control (lane 1) and < /b> the patient (lane 2) were subjected to SDS ⁄ PAGE and < /b> blotted onto a < /b> PVDF membrane prior to incubation with a < /b> cocktail of monoclonal antibodies as described in the Experimental...

Ngày tải lên: 16/03/2014, 22:20

10 317 0
The a and b adapters are used as priming sites for both amplification

The a and b adapters are used as priming sites for both amplification

... the wells not allow more than one ssDNA bead to be loaded into a < /b> well • Enzyme beads and < /b> packing beads are added Enzyme beads containing sulfurase and < /b> luciferase, and < /b> packing beads used only ... are broken, and < /b> the beads are released • Enrichment beads are added (containing biotin); these attach to DNA rich beads only • A < /b> magnetic field filters all DNA rich beads from empty beads, and < /b> ... The B adapter contains a < /b> 5’ biotin tag used for mobilization • The beads are magnetized and < /b> attract the biotin in the B adaptors Filtering the Mess • There are four adaptor combinations that are...

Ngày tải lên: 19/03/2014, 22:32

19 390 0
Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from flax – linolipins A and B docx

Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from flax – linolipins A and B docx

... flax leaves Galactolipids were separated and < /b> purified as described in Materials and < /b> methods EDE content was measured by UV absorbance of MGDG and < /b> DGDG fractions at 267 nm Average values and < /b> standard ... diglyceride, from Arabidopsis thaliana J Biol Chem 276, 12832–12838 42 Hisamatsu Y, Goto N, Hasegawa K & Shigemori H (2003) Arabidopsides A < /b> and < /b> B, two new oxylipins from Arabidopsis thaliana Tetrahedron ... mass spectral data This work was supported in part by Grant 09-04-01023 -a < /b> from the Russian Foundation for Basic Research and < /b> a < /b> grant from the Russian Academy of Sciences (program ‘Molecular and...

Ngày tải lên: 23/03/2014, 05:22

10 387 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

... (Hsp9 0a,< /b> forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp9 0b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... Hsp90 clients and < /b> Hsp90 inhibitor sensitivity in such strains; analysis that showed that many mammalian clients are able to be activated by both Hsp9 0a < /b> and < /b> Hsp9 0b Whether Hsp9 0a < /b> or Hsp9 0b is expressed ... a < /b> kinase and < /b> as a < /b> substrate depends on the molecular chaperone Hsp90 Proc Natl Acad Sci USA < /b> 96, 109–114 26 Citri A,< /b> Harari D, Shochat G, Ramakrishnan P, Gan J, Eisenstein M, Kimchi A,< /b> Wallach...

Ngày tải lên: 23/03/2014, 07:20

11 427 0
Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt

Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt

... water for each Partial acetylation of serines and < /b> threonines was avoided by adding 12 lL of a < /b> solution containing 0.5 mm hydroxylamine and < /b> 100 mm NaOH to the reaction chamber and < /b> incubating at ... pathway for light-dependent chlorophyll biosynthesis in Arabidopsis thaliana Plant Physiol 108, 1505–1517 Oosawa N, Masuda T, Awai K, Fusada N, Shimada H, Ohta H & Takamiya K (2000) Identification ... and < /b> potassium alkali metal and < /b> various di- and < /b> tri-alkali metal adducts if standard solvents with 0.1% formic acid were used for the UPLC separation (Fig 2A)< /b> In addition, the alkali metal adducts...

Ngày tải lên: 30/03/2014, 02:20

8 362 0
Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc

Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc

... Tremblay A < /b> & Doucet E (2000) Obesity: a < /b> disease or a < /b> biological adaptation? Obes Rev 1, 27–35 47 Binkova B, Smerhovsky Z, Strejc P, Boubelik O, Stavkova Z, Chvatalova I & Sram RJ (2002) DNA-adducts ... accumulation of fat mass remains to be determined Available epidemiological data addressing the implication of PAH, in general, as a < /b> causal factor in the pathogeny of metabolic disorders are currently ... increased fat mass, as indicated by results of body composition analysis Our interpretation of these data is that chronic inhibition by B [a]< /b> P of physiological b- adrenergic and < /b> ACTH stimulation caused...

Ngày tải lên: 30/03/2014, 11:20

11 425 0
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

... phylogenetic analysis Enzyme Species GenBank/EBI A < /b> transferase A < /b> transferase A < /b> transferase A < /b> (cis A/< /b> B) transferase A-< /b> likea Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase ... Ó FEBS 2002 kidney, the urinary bladder, the uterus and < /b> the thymus A < /b> weaker signal was obtained from the pancreas and < /b> very weak, barely detectable, signals were visible from a < /b> salivary gland, ... intestine Caecum Large intestine Pancreas Parotid gland Submaxillary gland Liver Trachea Lung Kidney Urinary bladder Ovary Uterus Testis Seminal vesicle Thyroid gland Parathyroid gland Brain Muscle...

Ngày tải lên: 31/03/2014, 09:20

8 499 0
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

... antagonism on prostaglandin and < /b> leukotriene synthesis in glomerular immune injury J Laboratory Clin Med 134, 478–482 Ushikubi, F., Aiba, Y., Nakamura, K., Namba, T., Hirata, M., Mazda, O., Katsura, ... 45 by up-regulating the synthesis and < /b> release of endogenous basic fibroblast growth factor J Biol Chem 268, 17397–17403 Lianos, E .A < /b> & Bresnahan, B .A < /b> (1999) Effect of thromboxane A2< /b> inhibition and < /b> ... PROCEDURES Materials UltraspecTM total RNA isolation system was obtained from Biotecx Laboratories, Houston, TX, USA < /b> Perfectly Blunt Cloning kit, and < /b> Pellet-paint coprecipitant, was obtained from Calbiochem-Novabiochem,...

Ngày tải lên: 31/03/2014, 09:20

16 321 0
d. to stay --> b 114. A artist went to a beautiful part of the country for a holiday, and stayed pdf

d. to stay --> b 114. A artist went to a beautiful part of the country for a holiday, and stayed pdf

... everyday, has breakfast at eight o'clock, and < /b> starts works at half past nine a < /b> at b has c starts d works > d 241 Peter usually gets up at eleven o'clock and < /b> has breakfast on lunchtime a < /b> usually b ... each other but men did a < /b> don't b as c to d did > d 266 A < /b> Suez Canal connects the Mediterranean Sea and < /b> the Gulf of Suez and < /b> separates the continents of Africa and < /b> Asia a < /b> A b connects c separates ... England a < /b> Most b same c any d > c 239 In Canada much people speak English because they also came from England many years ago a < /b> In b much c because d also > b 240 Jim gets up at half past seven...

Ngày tải lên: 18/06/2014, 17:20

28 2,2K 1
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx

Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx

... Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC 216 bases TGCCTTATATGTTCGTCTGTAGGAGCGAGT GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC Drosophila TATTGTACCTGGAGATATATGCTGACACGC 726,713 ... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG Consensus (1851) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... Journal 2007, 4:102 http://www.virologyj.com/content/4/1/102 A < /b> HindIII XbaI BamHI BamHI BamHI AvrII SpeI EcoRI SpeI HindIII SphI XbaI XbaI BamHI * XbaI BamHI BamHI SacI BamHI * EcoRI BamHI SacI BamHI...

Ngày tải lên: 18/06/2014, 18:20

12 567 0
w