a topdown approach featuring the internet 4th edition

... two) of alternating ACK 0 and ACK 1 even if the corresponding data have not arrived at the receiver Would this application design increase the channel utilization? Why? Are there any potential problems ... approach? Explain Answer Yes This actually causes the sender to send a number of pipelined data into the channel Yes Here is one potential problem If data segments are lost in the channel, then ... message của tầng ứng dụng với header của tầng giao vận - Datagram: đóng gói segment của tầng giao vận với header của tầng mạng - Frame: đóng gói datagram của tầng mạng với header của tầng liên

Ngày tải lên: 28/02/2015, 19:04

... that these ten cars follow each other in a fixed order You can think of each car as a bit and the caravan as a packet Also suppose that each toll booth services (i.e., transmits) a car at a rate ... of one car per 12 seconds, and that it is late at night so that the caravan's cars are only cars on the highway Finally, suppose that whenever the first car of the caravan arrives at a toll booth, ... departure-gate-to-arrival-gate transfer of a person and their bags is accomplished At the takeoff/landing layer, runway-to-runway transfer of a person (actually, many people) and their bags, is accomplished

Ngày tải lên: 14/08/2014, 13:21

... each node IP passes the datagram to the link layer, which delivers the datagram to the next node along the route At this next node, the link layer passes the IP datagram to the network layer The ... three phases: authorization, transaction and update During the first phase, authorization, the user agent sends a user name and a password to authenticate the user downloading the mail During the ... NBP (at an NBP hub), but it can also tap directly into an NAP, in which case the regional NBP pays a monthly fee to a NAP instead of to a NBP A regional ISP can also tap into the Internet backbone

Ngày tải lên: 14/08/2014, 13:21

... data from the upper-layer via the rdt_send(data)event, puts the data into a packet (via the action make_pkt(packet,data)) and sends the packet into the channel In practice, the rdt_send(data)event ... the canonical name for a hostname As an example, (foo.com, relay1.bar.foo.com, CNAME) is a CNAME record If Type=MX, then Value is a hostname of a mail server that has an alias hostname Name As ... structure The application data occupies the data field of the UDP datagram For example, for DNS, the data field contains either a query message or a response message For a streaming audio application,

Ngày tải lên: 14/08/2014, 13:21

... extreme, a transport layer protocol can provide a variety of guarantees to applications, such as reliable delivery of data, delay guarantees and bandwidth guarantees Nevertheless, the services that a ... added variables (similar to programming language variables) for base and nextseqnum, and also added operations on these variables and conditional actions involving these variables Note that the extended-FSM ... forward from the top of the diagram towards the bottom of the diagram; note that a receive time for a packet is neccessarily later than the send time for a packet as a result of transmisison and

Ngày tải lên: 14/08/2014, 13:21

... multicast support at the network layer In this latter approach, a single datagram is transmitted from the sending host This datagram (or a copy of this datagram) is then replicated at a network ... each of the receivers An applicationlevel data unit that is passed to the transport layer is then duplicated at the sender and transmitted over each of the individual connections This approach ... E and F can exchange IPv6 packets, the arriving IPv4 packets at E from D not contain all of the fields that were in te original IPv6 packet sent from A An alternative to the dual stack approach,

Ngày tải lên: 14/08/2014, 13:21

... contains a multicast datagram When the unicast datagram arrives at B, B then extracts the multicast datagram B may then forward the multicast datagram on to one of its attached hosts, forward the ... and multicast address fields) is carried as the payload of an IP unicast datagram - a complete multicast IP dagram inside of a unicast IP datagram! The unicast datagram is then addressed to the ... individual connection to each of the receivers What are the drawbacks of this approach compared to the approach that provides native multicast support at the network layer? What are the advantages

Ngày tải lên: 14/08/2014, 13:21

... an IP datagram from one host to another host, with both hosts on the same Ethernet LAN Let the sending adapter, adapter A, have physical address AA-AA-AA-AA-AA-AA and the receiving adapter, adapter ... network layer That is to say, when adapter A wants to send a datagram to adapter B, adapter A encapsulates the datagram in an Ethernet frame and sends the frame into the LAN, without first "handshaking" ... data, even though this datagram contains data that has already been transmitted at least once Baseband Transmission and Manchester Encoding Ethernet uses baseband transmission, that is, the adapter

Ngày tải lên: 14/08/2014, 13:21

... all the samples are concatenated together to form the digital representation of the signal As an example, if an analog audio signal is sampled at 8,000 samples per second , each sample is quantized ... message, launches the associated media player, and passes the file to the media player The media player then renders the audio/video file Figure 6.2-1 A naive implementation for audio streaming Although ... sees the content-type for the file, it can launch the appropriate media player, and thereby have the media player directly contact the server We have have just learned how a meta file can allow a

Ngày tải lên: 14/08/2014, 13:22

... header, it determines the SA for the packet and then authenticates the integrity of the datagram by processing the authentication data field The IPsec authentication scheme (for both the AH and ... the original IP datagram data with header and trailer fields, and then inserting this encapsulated data into the data field of an IP datagram For the protocol field in the header of the IP datagram, ... the AH header augments the original data field, and this augmented data field is encapsulated as a standard IP datagram For the protocol field in the IP header, the value 51 is used to indicate

Ngày tải lên: 14/08/2014, 13:22

... security capabilities STA and AS mutually authenticate, together generate Master Key (MK) AP servers as “pass through” STA derives Pairwise Master Key (PMK) STA, AP use PMK to derive Temporal Key ... Networking: A Top Down Approach Featuring the Internet, 3rd edition Jim Kurose, Keith Ross Addison-Wesley, July 2004 Slide biên dịch sang tiếng Việt theo cho phép tác giả All material copyright ... security payload (ESP)   với AH ESP, nguồn – đích bắt tay nhau:  tạo kênh logic lớp network gọi security association (SA)  SA theo chiều  xác định bởi:  giao thức bảo mật (AH ESP)  địa IP nguồn

Ngày tải lên: 04/12/2015, 08:13

... network data link physical ca gi lo r application transport network data link physical application transport network data link physical available: r r delay guarantees bandwidth guarantees Transport ... IP datagrams each datagram has source IP address, destination IP address r each datagram carries transport-layer segment r each segment has source, destination port number Ì host uses IP addresses ... TCP and UDP application transport network data link physical application transport network data link physical Transport Layer 3-4 Transport vs network layer Ì network layer: logical communication

Ngày tải lên: 27/06/2014, 16:20

... to the Web application; for example, they are also used for authentication and data encryption for IMAP mail access SSL can be viewed as a layer that sits between the application layer and the ... subsequent payment capture Acquirer gateway: The acquirer gateway is the software component at the merchant's bank It processes the merchant's payment card transaction for authorization and payment ... for fraudulent transactions Thus, if a customer makes a MOTO purchase with a payment card and claims to have never made the purchase, then the merchant is liable, that is, the merchant is legally

Ngày tải lên: 14/08/2014, 13:22

... trucks must have these flaps or go around the state This Kansas law: A is valid because it applies only to Kansas roads and such a law is entirely intrastate B is valid because Kansas' right to ... enforcement of the federal Controlled Substances Act (CSA) in medical marijuana cases They claimed enforcement violated the Commerce Clause because the medical marijuana was cultivated and possessed ... When a state action or statute advances a legitimate state objective such as an economic or social issue that is solely intrastate, the state need only prove a rational basis for the law When an

Ngày tải lên: 18/11/2017, 09:00

... teacher creates a climate for partnerships with families a Interview a teacher about the steps he or she takes at the beginning of the year to build partnerships with families Ask about the practices ... beginning of the year to create a climate for partnerships with family members Ask about the practices modeled by the teacher in the chapter Compare answers with material from the chapter about building ... (EI) was delineated by Mayer and Salovey and popularized by Goleman In Goleman’s construct, EI has four components: self-awareness, selfmanagement, social awareness, and relationship management

Ngày tải lên: 01/03/2019, 10:03

... Pearson Education LTD Pearson Education Australia PTY, Limited Pearson Education Singapore, Pte Ltd Pearson Education Asia, Ltd Pearson Education Canada, Ltd Pearson Educación de Mexico, S.A ... C.V Pearson Education—Japan Pearson Education Malaysia, Pte Ltd The Library of Congress cataloging-in-publication data is on file Praise for Trading Commodities and Financial Futures, Third Edition ... individual trader always loses against the Goliaths in the markets.” —Mary Cashman, Head of International Operations, Global Commodity Intelligence “Discipline and execution are the two most important

Ngày tải lên: 09/01/2020, 09:00

... Fitzgerald’s translation of the Rubaiyat is re- garded in the nature of a miracle. For the general case, it would seem that characterizing a sample of the translator’s art as a good translation ... [ Mechanical Translation , Vol.6, November 1961] A New Approach to the Mechanical Syntactic Analysis of Russian by Ida Rhodes*, National Bureau of Standards This paper categorically rejects the ... considering a word- to-word conversion as a translation. A true translation is unattainable, even by the human agent, let alone by mechanical means. However, a crude practical translation is probably

Ngày tải lên: 16/03/2014, 19:20

... However, there is a clever way to extract information from this matrix without going into involved mathematical anal- ysis. The idea is to optimize the above scattering equation using a variation approach ... as a channel variable As noted so far, the key point in dealing with MIMO and its performance is how to model the random channel matrix H . The latter is in general a non Hermitian rectangular ... for the data). Recall also that CDMA is a modulation and multiple-access using a spread spectrum communication which is used in civil- ian and military communication. It has the ability to combat

Ngày tải lên: 22/06/2014, 19:20

... 1 (a has a local maximum at k) + 1 A k (a) , if k < n, and 1  a (n) has a local maximum at n  = 1 (a has a local maximum at n) + 1 A n (a) + 1 A ′ n (a) + 1 A ′′ n (a). Hence, LA n (a (n) ... say that a has a local minimum at the index k if (i) a k < a k+1 or k = n, and (ii) a k < a k−1 . An observation that comes in handy is the fact that counting the length of the longest alternating ... since (a t 1 , a s 1 , a t 2 , a s 2 , . . .) is an alternating subsequence of a, we have LA n (a) ≥ r + r ′ = # local maxima +# local minima. To establish the opposite inequality, take a maximal

Ngày tải lên: 08/08/2014, 12:23

... CCCCATGTCGCCTTTAGT OMCB-KO-R TCGCTAGAACACATTGAC OMCA-F ATGATGAAACGGTTCAAT OMCA-R TTAGTTACCGTGTGCTTC OMCB-F CTGCTGCTCGCAGCAAGT OMCB-R GTGTGATCTGCAACTGTT OMCA-PBAD-F CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC OMCA-PBAD-R ... CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC OMCA-PBAD-R TTAGTTACCGTGTGCTTC OMCB-PBAD-F CACCGAGGAATAATAAATGATG AACGCACAAAAATCA OMCB-PBAD-R TTACATTTTCACTTTAGT Shewanella oneidensis MR-1 OmcA and OmcB kinetics J. Borloo et al. 3736 ... used as a positive control to display omcA (lane 1) and omcB (lane 6). DNA standards are indicated at the left and right of the agarose gels. (B) Visualization and separation of high molecular mass...

Ngày tải lên: 07/03/2014, 09:20