a tool for the automatic creation

... distally along the shoe), medial (greater medial than lateral wear at the heel and forefoot), which may indicate excessive pronation, or lateral (greater lateral than medial wear at the heel and forefoot), ... shoes, and sandals. The range for each quantitative measure from the included footwear can be found in Table 1. Intra-rater reliability Intra-rater ICCs and 95% LOAs for quantitative measures are ... exception of the thumb width item for rater 1 and the last shape item for rater 2. Intra-rater kappa and percentage agreement statistics for categorical meas- ures from the tool are shown in Table 3.

Ngày tải lên: 10/08/2014, 21:23

... gradual accumulation on the stigma, and further expansion toward the style and the ovary after anther dehiscence. At the post-anthesis phase, the Ca 2+ signal on the stigmatic surface decreased, ... showed the accumulation of Ca/Sb precipitates in the vacuoles of the stigma cells as well as in the intracellular spaces between them. The stigmatic surface is the main place for signal exc hange ... pool increased progressively and reached the maximal valu es just after anther dehiscence (stage 4). At the latest analyzed stage (stage 5) a signifi- cant decrease of Ca 2+ levels was obser ved

Ngày tải lên: 11/08/2014, 11:21

... as part of a database schema ensures that such ques- tions 'mean' the same thing in different databases. SO also greatly facilitates the automatic validation of annota- tion data, as ... a database schema, nor is it a file format; it is an ontology. As such, SO transcends any particular database schema or file format. This means it can be used equally well as an external data-exchange ... This can make it hazardous to exchange, combine and compare annotation data. Clearly, if genomic annotations were always described using the same language, then comparative analysis of the wealth

Ngày tải lên: 14/08/2014, 14:21

... relationship between the variables X and Y? a b c d As the value of X increases, the value of Y decreases As the value of Y increases, the value of X decreases As the value of X increases, the ... of the following statements most clearly represents an effort at a nomothetic explanation? a a study attempting to show whether all juveniles who shoplift have a weak attachment to their parents ... delivery ANS: A PG: 25-26 15 A theory would be best defined as: a speculations that social scientists make regarding human behavior and social phenomena b a set of interrelated, abstract concepts and

Ngày tải lên: 08/09/2017, 09:15

... Alla Anohina-Naumeca University of Latvia, Latvia Riga Technical University, Latvia Recommended citation: Anohina-Naumeca, A (2015) Justifying the usage of concept mapping as a tool for the formative ... mapping as a tool for the formative assessment of the structural knowledge of engineering students Alla Anohina-Naumeca* Faculty of Education, Psychology, and Art University of Latvia, Latvia ... maps can provide rich information about students’ knowledge states Regardless that this information can have both a quantitative nature and a qualitative nature, the main value coming from the

Ngày tải lên: 10/01/2020, 05:47

... used for the positive validation dataset and 90% was employed for the positive training dataset These same separation ratio was used for the negative validation and the negative training datasets ... sequences based on the EC nomenclature Alperen Dalkiran1,2, Ahmet Sureyya Rifaioglu1,3, Maria Jesus Martin4, Rengul Cetin-Atalay5,6, Volkan Atalay1,5* and Tunca Doğan4,5,6* Abstract Background: The automated ... https://github.com/cansyl/ECPred/ Authors’ contributions MJM, RCA, VA and TD conceived the idea and the methodological approach AD, ASR, VA and TD performed the system construction AD performed all data analysis AD and ASR

Ngày tải lên: 25/11/2020, 14:35

... Systems (UASs) for both military and commercial applications As the utilization of UASs continues to increase, the design of improved propellers for these UASs is an important area for research The ... determined at each radial station This is accomplished by calculating 𝐶𝐿 as a function of the helix angle (𝜙), Prandtl loss factor (𝐹), 𝐵, 𝑟, the tip radius (𝑅), the local wake advance ratio (𝜆𝑊 ), the ... predictions for CLPROP are similar to the experimental results validating the potential accuracy of the aerodynamic calculations of the spreadsheet The power required is a function of the rotational speed

Ngày tải lên: 24/10/2022, 02:56

... natural or artificial languages. While an automatic formula finder may eventually serve as an important aid for research in automatic language translation, such a system cannot replace the ... than will actually be needed in the formula; the machine will use only those variables that are actually required. A. THE AUTOMATIC SPECIFICATION OF VARIABLES AND EVALUATION OF FORMULAS Variables ... Its operation is based on the automatic as- sociation of basic algorithms with dictionary entries, the automatic specification of variables, and the auto- matic evaluation of formulas. The proposed

Ngày tải lên: 16/03/2014, 19:20

... below Stationarity Weak stationarity implies that the mean and variance of the signal not change over time Determination of stationarity is important in selecting the appropriate analytical method, ... distributed as a standard normal with zero mean and unit variance Hence, at the 5% significance level, |zA| < 1.96 for a stationary signal For a step-by-step procedure for calculating the number ... separating aspirations and swallows Figure depicts the feature space for this optimal 2-dimensional feature combination We can visually verify that swallows and aspirations are roughly quadratically

Ngày tải lên: 19/06/2014, 10:20

... shade, so that by the time they are ready for planting they will be able to withstand the natural environment with minimal care Once the shade has been gradually removed... leaves can ... used as an insecticide or to prevent rats from eating seedlings Mix 300g of dry plant material with 1 litres of water and soak for 24 hours Strain the liquid and apply Papaya (Carica papaya) ... planted in the field; or they can be sown in a pot and then planted in the field All three ways have advantages and disadvantages Bare-rooted seedlings (those from seedbeds) are easier

Ngày tải lên: 27/06/2014, 13:20

... improve the annotation features and abilities of the database. The rate limiting step for input of data into the database is the manual reading of papers by annotators and their reformatting of the ... information in the data. Comparison to other TF binding site databases The goals and features of the NFI-Regulome database appear unique among TF binding site databases. There are a number of databases ... displaying information: Basic Search Page The home page of the database is also the Basic Search page (Figure 3 A). It is anticipated that two major search types will be performed: 1) searching for

Ngày tải lên: 10/08/2014, 09:22

... VB and MP. Analysis and interpretation of the data using IsoBED: AA, LS, MP and VB. Drafting of the manuscript: VB, AA, MB and LS. Final approval of the article: All authors read and approved the ... select and evaluate the best approach able to guarantee maximum TCPandatthesametimetheminimumNTCPtothe organs at risk. Appendix 1 TCP Assuming that the cell survival in a tumor follows a binomial ... Vicente Bruzzaniti * , Armando Abate, Massimo Pedrini, Marcello Benassi and Lidia Strigari Abstract Background: An advantage of the Intensity Modulated Radiotherapy (IMRT) technique is the feasibility

Ngày tải lên: 10/08/2014, 10:21

... implementation of strategies at a reasonable cost; and lead to maintained self-management in patients and sustained delivery within primary care clinics [19,35,36]. RE-AIM can be a valuable planning ... patient- healthcare team encounters more informed and patient-centered. Formative research with 3 clinicians indicated that the program addressed a number of practical concerns and they appreciated ... and maintenance/sustainability (e.g., integration with current National Committee for Quality Assurance recommendations and clinical pathways of care). Connection to Health can work on a variety

Ngày tải lên: 10/08/2014, 11:20

... systematically evaluated and the best values found are used as defaults. Jane can import its files in either Tarzan or a Nexus- based format. A file m ust specify the host and parasite trees and the ... are mutated in the genetic algorithm, among others. These parameters are not exposed in the graphical user interface but can be s et in the command-line version of Jane. Values of the se parameters ... describes the theory and implementation of a new software tool, called Jane, for the study of historical associations. This problem arises in parasitology (associations of hosts and parasites),

Ngày tải lên: 12/08/2014, 17:20

... instance, a query as to whether a gene of interest has an association with any of the available diseases. Hierarchical 'parent/child' relations are also available and can be visual- ized. They ... Honda K, Mihara H, Kato Y, Yamaguchi A, Tanaka H, Yasuda H, Furu- kawa K, Urano T: Degradation of human Aurora2 protein kinase by the anaphase-promoting complex-ubiquitin-pro- teasome pathway. ... feedback and contributed to the manuscript. JK supervised the work and revised the manuscript. Additional data files The following additional data are available. Additional data file 1 is a table

Ngày tải lên: 14/08/2014, 08:21

... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGAGGATGACACTTCGGCCGATGAG>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>CAGGATAAGGAGATTGATCTGCCAGAGTCC ... add Clear User-Defined Exons Table mRNA (1802 nucleotides) AGCACCGCGCAGGCGCTGCGGAGCCGCGCGGAGGAAGTTTGAACG GTGGCGGGTACCGGAGCCGCTGATGGAGTCCGTGCTGAAAGGTAT ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA

Ngày tải lên: 14/08/2014, 16:21

... manually can be laborious and time consuming. Assays that measure metabolic activity Metabolic activity can be an indication of cell viability. There are several metabolic based assays available ... or colorimetric assays, both having several disadvantages. The first method can be laborious and involves hazardous materials and wastes, whereas the latter is nonspecific to collagen. Therefore, an alternative ... method can be laborious and involves hazardous materials and wastes, whereas the latter is nonspecific to collagen Therefore, an alternative collagen quantification assay that is based on immunocytochemistry

Ngày tải lên: 09/10/2015, 11:07

... remarkable mesoforms in the alluvial plain (e.g remnants of oxbow lakes or abandoned meanders) are proof of the natural migration and shift of the river channel in the past This area has a very ... fluvial erosion and typical fluvial landforms both in the channel and in the alluvial plain; Kopce typical and well-visible pseudokarst caves) Economical value was the same for all the sites because ... – – – A considerable number of various types of landforms (cryogenic, gravitational and fluvial landforms, a large diversity of small weathering forms) Study area is a part of Natural park Vizovické

Ngày tải lên: 30/12/2018, 14:47

... facilities at Clonee for the duration of the work To Paul O’Hanlon, Area Technical Manager, for assisting with all matters on site in Clonee and to Barry and Gary in the lab for the help with the testing, ... me and to the rest of my family and friends for the support and encouragement they continuously offered that was often not acknowledged, but was always appreciated A Decision Making Tool for the ... where the same slabs are cast as the structure rises The flowchart could also be applied to other elements such as columns, beams or walls If the project is not suitable then consider the standard

Ngày tải lên: 03/11/2019, 10:12

... flavor, and stronger in after-taste than the sample with a regular aroma concentration. The heightened aroma concentration caused a slight off-flavor described as ‘artificial’. The manufacturer packaged ... and half ate the heightened aroma samples first. The subjects were asked to rate one sample a day at any time of the day they wanted. Similarly to the tasting sessions, the odor intensity was rated ... (Thomas-Danguin et al., 200 3a) ). Data analysis Repeated measures analysis of variance was used to test the within-subject effect of aroma concentration of the sample (two levels) and the day of eating...

Ngày tải lên: 03/04/2013, 21:06