... (2.1), and no ri is zero Therefore, after permuting the rows and columns of the adjacency matrix of G it is a block diagonal matrix in which every block is an all-1 square matrix, and as our graph ... of H with more than vertices, (as there are ways to orient each such cycle as a directed cycle and get a contribution to the permanent) Thus the square of the number of perfect matchings is at ... states n perm A ≤ (ri !) ri , (2.1) i=1 where equality holds (if no ri is zero) iff up to permutation of rows and columns A is a block diagonal matrix in which each block is a square all-1 matrix...
Ngày tải lên: 07/08/2014, 15:22
... hda1, hda2, and hda3 are all physical volumes We'll initialize hda3 as a physical volume: root@lappy:~# pvcreate /dev/hda3 If you wanted to combine several disks, or partitions you could the same ... that we have a volume group (called skx-vol) we can actually start using it Working with logical volumes What we really want to is create logical volumes which we can mount and actually use In ... pretend that the test partition is full and we want to make it bigger First of all we can look at how big it is at the moment with lvdisplay: root@lappy:~# lvdisplay - Logical volume LV Name...
Ngày tải lên: 18/09/2012, 10:12
Báo cáo y học: "A cyclic-RGD-BioShuttle functionalized with TMZ by DARinv “Click Chemistry” targeted to αvβ3 integrin for therapy"
... chloroform and ml TEA at 0-5 °C After h at room temperature, the solution was washed with water, N HCl and again with water The organic layer was dried over Na2SO4 and evaporated The residue was purified ... coloured and maintained for h at room temperature Then the organic phase was washed with water, followed by 1N HCl and again water The organic layer was dried over Na2SO4 and evaporated The resulting ... Integrins alpha v beta and alpha v beta promote adenovirus internalization but not virus attachment Cell 1993; 73: 309-19 339 21 Gasparini G, Brooks PC, Biganzoli E, et al Vascular integrin alpha(v)beta3:...
Ngày tải lên: 25/10/2012, 11:40
Hiiriing_ For A Perfect Fiit.
... Are A Perfect Fit Chapter Five Hiring Sales Representatives That Are A Perfect Fit Chapter Six Hiring Sales Managers That Are A Perfect Fit Chapter Seven Hiring Department Managers That Are A ... www.xbcoaching.com Chapter Seven Hiring Department Managers That Are A Perfect Fit © Kathi Graham-Leviss http://www.xbcoaching.com Regardless of the particular area of the company, each department manager ... Individuals who show a high Compliance style are those that tend to process more methodically and are focused on tasks These individuals tend to be analytical, precise, and value quality and accuracy...
Ngày tải lên: 06/11/2012, 15:40
OReilly.Building.a.Web.2.0.Portal.with.ASP.NET.3.5.Jan.2008-BBL
... Data access layer Encapsulates database access and provides an interface that is database and data source independent It also provides object factories that create Entity classes out of database ... with the database DatabaseHelper is a class used for performing common database operations DashboardDataContext is generated by LINQ to SQL and maps entities to database tables Data Model To ... that work with databases via DatabaseHelper and DatabaseContext On the web layer, Default.aspx is the entry point It uses DashboardFacade to perform operations such as adding a new tab or widget,...
Ngày tải lên: 15/11/2012, 14:24
Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil
... low value lipids as feed stocks: Vegetable oil soap stock, Fuel Processing Technology 86 (2005): 1087 – 1096 Sukumar Puhan, Vedaraman N, Ramabrahamam B.V, Nagarajan.G, Mahua (Madhuca indica) seed ... 16, 17] Alkali catalyzed transesterification is faster than acid catalyzed transesterification and is most used commercially [18] If the free fatty acid (FFA) content and moisture content are less ... 349 Deepak Agarwal, Avinash Kumar Agarwal, Performance and emissions characteristics of Jatropha oil (preheated and blends) in a direct injection compression ignition engine, Applied Thermal Engineering...
Ngày tải lên: 05/09/2013, 16:11
speaking- a perfect job
... Student B: No, I don’t think so I don’t sing very well OR I’d love to! Great idea! ...
Ngày tải lên: 06/09/2013, 15:10
Tài liệu tiếng anh Điện tử công suất mạch MERS Loss and rating consideration of a wind energy conversion system with reactive compensation by magnetic energy recovery switch
... Ryuichi Shimada, Jan A Wiik, Takanori Isobe, Taku Takaku, Noriyuki Iwamuro, Yoshiyuki Uchida, Marta Molinas, and Tore M Undeland A new ac current switch called mers with low on-state voltage igbts ... zero to rated voltage within the current rating of the device This also means that the series voltage injection capability stays constant even with varying frequency A major advantage with the ... mode the capacitor voltage goes to zero during each cycle As a result of the control, the MERS can act as a variable capacitor The size of the capacitive injected series voltage can be varied from...
Ngày tải lên: 15/10/2013, 16:11
What Makes a Perfect Parent
... child-resistant packaging (an estimated fifty lives a year), flame-retardant pajamas (ten lives), keeping children away from airbags in cars (fewer than five young children a year have been killed by airbags ... A s and was hated for it; I spoke correctly and was called a punk I had to learn a new language simply to be able to deal with the threats I had good manners and was a good little boy and paid ... (That’s why the school-choice lottery in Chicago was such a happy accident.) What an economist typically has is a data set with a great many variables, none of them randomly generated, some related...
Ngày tải lên: 17/10/2013, 18:20
Tài liệu 20 Terabytes a Night by Doug Rosenberg with Matt Stephens doc
... database enables a diverse multidisciplinary research program: astronomy & astrophysics; machine learning (data mining); exploratory data analysis; extremely large databases; scientific visualization; computational science & distributed computing; and ... databases; scientific visualization; computational science & distributed computing; and inquiry‐based science education (using data in the classroom). Many possible scientific data mining use cases are anticipated with this database. The LSST scientific database will include: ... * Calibration, configuration, processing, and provenance metadata Sky Movies—Challenges of LSST Data Management The Data Management (DM) part of the LSST software is a beast of a project. LSST will deal with ...
Ngày tải lên: 13/12/2013, 00:15
Tài liệu Báo cáo khoa học: A novel dicyclodextrinyl diselenide compound with glutathione peroxidase activity ppt
... mitochondria was analyzed by thiobarbituric acid assay [34] In this assay, thiobarbituric acid reacts with malonaldehyde and ⁄ or other carbonyl by-products of free-radicalmediated lipid peroxidation ... thiobarbituric acid reactive substances (TBARS) as a marker for lipid peroxidation, and 6-CySeCD, 6-SeCD and Ebselen as antioxidants in ferrous sulfate ⁄ ascorbate-induced mitochondrial damage ... (e) damage Relative TBARS content calculated based on amount of TBARS for 50 with damage group ¼ on mitochondrial swelling and lipid peroxidaton in the absence of damage Exposing mitochondria in...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG ... Forward Reverse Reverse Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC ... 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 5¢rpsO 5¢rpsO 3¢rpsO 3¢rpsO 3¢rpsO-(T)18 rpsO internal 3¢rpsO-(C)18...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx
... cross-react with antibodies against plant helicases including PDH45 and PDH65 and also against human DNA helicases I, II, III and IV (data not shown) ssDNA-dependent ATPase activity was present at a ... 2A, lane 4) and ssDNA-dependent ATPase activity (data not shown) sedimented together between alcohol dehydrogenase and BSA (fraction 11) and gave a molecular mass of 120 kDa with a sedimentation ... substrates (Fig 5G and H) were prepared as described previously [11,15] 32 ATP-dependent DNA helicase and DNA-dependent ATPase assays The standard DNA helicase reaction was performed in a 10-lL reaction...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo khoa học: A synthetic weak neurotoxin binds with low affinity to Torpedo and chicken a7 nicotinic acetylcholine receptors docx
... first pair was X289 (5¢ TgTgCTACTTgCC CTggAA 3¢) and X191 The second pair was X133 (5¢ TCC AgAAAAgATCgCAA gATg 3¢) [35] and X300 (5¢ AgAgC CAAgCTTTTACT ATCggTT 3¢) The PCR products were fractionated ... analogue-to-digital interface board (DT2821, Data Translation, Marlboro, USA) Endplate potentials and miniature endplate potentials were analysed individually for amplitude and time course RESULTS Cloning and ... before and after application of toxins tested Electrical signals after amplification were collected and digitized, at a sampling rate of 25 kHz, with the aid of a computer equipped with an analogue-to-digital...
Ngày tải lên: 21/02/2014, 03:20
Tài liệu Báo cáo khoa học: "WebCAGe – A Web-Harvested Corpus Annotated with GermaNet Senses" docx
... sense mapping of GermaNet with Wiktionary, the example sentences are automatically sense-annotated and can be included as part of WebCAGe Additional material for WebCAGe is harvested by following ... selection and annotation of the representative examples in Yarowsky’s approach is performed completely manually and is therefore limited to the amount of data that can reasonably be annotated by hand ... Chiang Mai, Thailand, pp 883–892 Mihalcea, R., Moldovan, D 1999 An Automatic Method for Generating Sense Tagged Corpora Proceedings of the American Association for Artificial Intelligence (AAAI’99),...
Ngày tải lên: 22/02/2014, 03:20