... would also like to thank Mr Sacadevan Raghavan and Mrs Hung-Ang Yan Leng, the lab officers of the Air-Conditioning Laboratory in the Mechanical Engineering Department for their invaluable assistance ... global minimum while the training of neural networks may get “trapped” at a local minimum Another advantage is that training of the SVM is faster than that of neural networks This is a desirable ... ASHRAE Handbook Heating, Ventilating, and Air-Conditioning Applications Atlanta, GA: American Society of Heating, Refrigerating and Air Conditioning Engineers 1999 Bojkov, B., and R Luus, Evaluation...
Ngày tải lên: 22/10/2015, 21:14
... search algorithm for supplier performance evaluation: A case study * Behnam Vahdani , S Meysam Mousavi 2, R Tavakkoli-Moghaddam 3, H Hashemi Faculty of Industrial and Mechanical Engineering, Qazvin ... AI approaches, they can more effectively deal with complexity and vagueness inherent in decision-making than conventional methods 2.5 Statistical/probabilistic approaches A simulation-based approach ... by using a real data set gathered from a case study for supplier selection and evaluation problem in a cosmetics industry Comparative analyses are also conducted to appraise the performance of...
Ngày tải lên: 05/05/2020, 09:20
Estimation of residual stress in welding of dissimilar metals at nuclear power plants using cascaded support vector regression
... using another data set excluding the learning data set Thus, the obtained data were segregated into three data sets: EP the learning data, verification data, and test data The learning data set was ... dissimilar metals was estimated in a relatively accurate manner using cascaded support vector regression (CSVR) as an artificial intelligence method The results indicate that the estimated data obtained ... intervals among the remaining data The verification data and the test data accounted for 80% and 20%, respectively, of the remaining data The test data, excluding the learning RI PT data and the...
Ngày tải lên: 24/11/2022, 17:50
Báo cáo hóa học: " Research Article A Principal Component Regression Approach for Estimating Ventricular Repolarization Duration Variability" pot
... Approach for Estimating Ventricular Repolarization Duration Variability Mika P. Tarvainen, 1 Tomi Laitinen, 2 Tiina Lyyra-Laitinen, 2 Juha-Pekka Niskanen, 1 and Pasi A. Karjalainen 1 1 Department ... Recommended by Pablo Laguna Lasaosa Ventricular repolarization duration (VRD) is a? ??ected by heart rate and autonomic control, and thus VRD varies in time in a similar way as heart rate. VRD variability ... leading the Re- search Group of Biomedical Signal Analysis and Medical Imaging. His research areas in- clude biomedical signal analysis and medi- cal imaging applications. Most of his work has...
Ngày tải lên: 22/06/2014, 23:20
Bayesian approach to support vector machines
... key data structures to save and manipulate the training data. 1. Pairs, which is a list to save training (or test) samples. Each node contains the input vector and the target value of a training ... simulated and real-world data sets indicate that the approach works well. Another merit of the Bayesian approach is that it provides a feasible solution to large-scale regression problems. For classification ... random variables E[·] expectation of a random variable K(·, ·) kernel function V ar[·] variance of a random variable α, α∗ column vectors of Lagrangian multipliers αi , αi∗ Lagrangian multipliers...
Ngày tải lên: 12/09/2015, 09:03
Srichart 2016-The SEACEN Centre-Determinants of MP transmission via bank lending channel in Thailand-A Threshold Vector Autoregression approach
... Chapter DETERMINANTS OF MONETARY POLICY TRANSMISSION VIA BANK LENDING CHANNEL IN THAILAND: A THRESHOLD VECTOR AUTOREGRESSION APPROACH1 By Kantapon Srichart2 Kongphop Wongkaew3 Suchanan Chunanantatham4 ... worth of a firm serves as a leading indicator of a borrower’s probability to default As a firm’s wealth deteriorates, adding to the possibility of a default, a bank may guard its wealth against ... interest rate channel alone According to Disyatat and Vongsinsirikul (2002), monetary tightening leads to a fall in bank credits with about quarters lag and bank loans also have significant implication...
Ngày tải lên: 18/06/2016, 20:30
Explaining turnover intention with organizational identification, perceived organizational support, protean career approach, and the mediating role of opganizational commitment a study of lecturers in viet nam
... Support, Protean Career Approach on Organizational Commitment (H1) .60 4.7.2 Effects of Organizational Identification, Perceived Organizational Support, Protean Career Approach, Organizational Commitment ... CORRELATIONS Confirmatory factor analysis for Organizational Identification, Perceived Organizational Support, Protean Career Approach and Turnover Intention Appendix E – 1: Standardized Appendix ... Confirmatory factor analysis for Organizational Identification, Perceived Organizational Support, Protean Career Approach and Turnover Intention 49 4.5.2 Confirmatory factor analysis...
Ngày tải lên: 10/01/2018, 10:30
The Fama-French three-factor model in Vietnam - a quantile regression approach
... Citation: Tran Thi Tuan Anh (2017) The Fama-French Three-Factor Model in Vietnam - A Quantile Regression Approach Banking Technology Review, Vol 1, No.2, pp 239-256 Tran Thi Tuan Anh - Email: anhttt@ueh.edu.vn ... negative at all quantiles and statistically significant at 1% With regard to the HML factor, although it is not statistically significant via OLS regression, it is found statistically significant at ... such as Japan by Charitou & Constantinidis (2004), Australia by Gaunt (2004), India by Bhavna (2006), Brazil by Silva (2006), France by Trimech, Kortas, Benammou & Benammou (2009), Indonesia by...
Ngày tải lên: 16/01/2020, 18:46
Determinants of capital structure of listed firms in Vietnam: A quantile regression approach
... Wellalage, N H., & Locke, S (2014) The capital structure of Sri Lankan companies: A quantile regression analysis Journal of Asia-Pacific Business, 15(3), 211–230 Wiwattanakantang, Y (1999) An ... conventional capital structure determinants, and particularly showcase the importance of profitability and depreciation as alternative financing sources and the ability of firm size and asset tangibility ... Shivdasani, A (2001) Leverage and internal capital markets: Evidence from leveraged recapitalizations Journal of Financial Economics, 59, 477–515 Rajan, R G., & Zingales, L (1995) What we know about...
Ngày tải lên: 03/02/2020, 17:36
Factors influencing the performance appraisal system among women and men: a comparative analysis using multinomial logistic regression approach
... Emmanuel Attah Kumah and Adelaide Konadu Amponsah, ? ?A Comparative Analysis of the Impact of Performance Appraisal System in Ghana: A Case Study of Ghanaian and Multinational Companies” International ... SYSTEM AMONG WOMEN AND MEN: A COMPARATIVE ANALYSIS USING MULTINOMIAL LOGISTIC REGRESSION APPROACH KDV Prasad Faculty of Commerce, Rashtrasant Tukdoji Maharaj Nagpur University, Nagpur, India Rajesh ... feedback method can be utilized by organizations as this method combines evaluations from various sources into over all appraisal (Garavan et al 1997) Performance ratings are based on rater evaluations...
Ngày tải lên: 09/07/2020, 02:05
The effect of financial stress index on the Vietnamese economic growth - A threshold auto regression approach
... Li F and St-Amant P.(2010) Financial stress, monetary policy, and economic activity Bank of Canada Working Paper 2010-12 May 2010 Avaliable at: https://www.bankofcanada.ca/wp-content/uploads/2010/05/wp10-12.pdf ... 2020 ANH THI LAM PHAM activity in five emerging Asian economies Tnga and Kwekb (2015) employed a structural vector autoregression (SVAR) for ASEAN- economies and found that an increase in financial ... financial stress index on the Vietnamese economic growth - A threshold auto regression approach Anh Thi Lam Pham Banking Academy of Vietnam After the 2008 global financial crisis, financial stress...
Ngày tải lên: 06/08/2020, 10:37
Determinants of capital structure of listed firms in vietnam, a quantile regression approach
... Wellagage and Locke (2014) for Sri Lankan firms and Qiu and Smith (2007) for UK companies Our data of firm-specific characters are obtained from Datastream for a sample of all non-financial firms ... of Sri Lankan companies: A quantile regression analysis Journal of Asia-Pacific Business, 15(3), 211-230 Wiwattanakantang, Y (1999) An empirical study on the determinants of the capital structure ... Shivdasani, A (2001) Leverage and internal capital markets: Evidence from leveraged recapitalizations Journal of Financial Economics, 59, 477-515 Rajan, R G., & Zingales, L (1995) What we know about...
Ngày tải lên: 18/09/2020, 08:46
the eq difference a powerful program for putting emotional intelligence to work
... don’t always end up as successful as Jack—what’s different about Jack?) His father’s parting message was, “Always act as a gentleman.” These words, spoken decades ago, called Jack to develop a sense ... Washington D.C Special discounts on bulk quantities of AMACOM books are available to corporations, professional associations, and other organizations For details, contact Special Sales Department, ... adult behavior Similarly, we may recognize that to live in our society, certain behaviors, such as murder, are more than illegal; they are simply not acceptable and may also be against our values...
Ngày tải lên: 03/06/2014, 01:01
turbocoach a powerful system for achieving breakthrough career success
... corporations, professional associations, and other organizations For details, contact Special Sales Department, AMACOM, a division of American Management Association, 1601 Broadway, New York, NY 10019 ... intentionally left blank TurboCoach A Powerful System for Achieving Breakthrough Career Success Brian Tracy and Campbell Fraser American Management Association New York • Atlanta • Brussels • Chicago • Mexico ... professional person should be sought Library of Congress Cataloging-in-Publication Data Tracy, Brian TurboCoach : a powerful system for achieving breakthrough career success / Brian Tracy and Campbell...
Ngày tải lên: 03/06/2014, 01:28
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... TGV-IYG AAC59453 (59aa) AAC55646 (60aa) AAD24564 (60aa) AAD24565 (60aa) AAC26682 (161aa) AAC26681 (161aa) AAD30140 (59aa) AAC55649 (60aa) AAC55650 (59aa) AAC55651 (59aa) AAC26684 (161aa) AAC55656 ... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo y học: "The discovery of potential acetylcholinesterase inhibitors: A combination of pharmacophore modeling, virtual screening, and molecular docking studies" pptx
... pharmacophore model used as the 3D query in database searching was retained as a hit Two database searching options such as Fast/Flexible and Best/Flexible search are available in DS V2.5.5 Of these ... G, Harel M, Giles K, Toker L, Velan B, Lazar A, Kronman C, Barak D, Ariel N, Shafferman A, Silman I, Sussman JL: Structures of recombinant native and E202Q mutant human acetylcholinesterase complexed ... generating the quantitative pharmacophore model A value of was employed as the uncertainty value, which means that the biological activity of a particular inhibitor is assumed to be located somewhere...
Ngày tải lên: 10/08/2014, 05:21
Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx
... this as an input to a separate "playback" application The "playback" is not strictly a playback in the sense that users are still allowed to move about and interact in the virtual world An example ... component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a much Fig 14.2 ... environment; for example, an application that allows a student driver to obtain training in a virtual environment VR devices such as head-position trackers, head-mounted displays, and data gloves are commonly...
Ngày tải lên: 23/01/2014, 07:20
Tài liệu Glycemic Load Diet: A POWERFUL NEW PROGRAM FOR LOSING WEIGHT AND REVERSING INSULIN RESISTANCE pdf
... transform carbohydrates to fat and fat to carbohydrates People can get just as fat eating carbs as they can eating fat In fact, unlike fat, carbohydrates stimulate your pancreas to secrete insulin, a ... with a rise in popularity of vegetarianism and a period of rampant inflation of meat and dairy product prices The result was an abrupt shift in eating patterns away from eggs, red meat, and dairy ... contain it are so familiar to us We’ve been eating bread, potatoes, and rice all our lives, as have our parents and grandparents Indeed, many people can get away with eating large amounts of starch...
Ngày tải lên: 15/02/2014, 15:20