a blueprint for security

Accounting for intergenerational income persistence: noncognitive skills, ability and education potx

Accounting for intergenerational income persistence: noncognitive skills, ability and education potx

... in March 1958 Parental income data is available only at age 16, meaning that the comparative analysis of this data is based only on income at this age The questions that ask about parental income ... intergenerational coefficient and the intergenerational partial correlation The estimates presented are based on the average of age 10 and age 16 parental income and are conditional on average parental ... comparable variables can be found in Appendix A For cognitive skills; reading, maths and general ability scores at age 11 are broadly comparable with the reading, maths and British ability scale...

Ngày tải lên: 23/03/2014, 03:20

39 298 0
Economic Statistics for NOAA

Economic Statistics for NOAA

... Research funded by National Oceanic and Atmospheric Administration, Coastal Ocean Program under awards NA87OA0381, NA96OP0187, NA06 0A0 388, and NA 16 0A1 449 to the University of Hawaii Coral Reef ... Secretary of Commerce for Oceans and Atmosphere Administrator, National Oceanic and Atmospheric Administration Washington, DC April 2005 Economic and Social Impacts Weather and Climate Impacts Weather ... Impacts of Drought and the Benefits of NOAA’s Drought Forecasting Services, NOAA Magazine, September 17, 2002 Website: http://www.noaanews.noaa.gov/magazine/stories/mag51.htm Average annual damage...

Ngày tải lên: 17/12/2013, 08:40

56 262 1
Tài liệu Statistics for Environmental Engineers P2 doc

Tài liệu Statistics for Environmental Engineers P2 doc

... 3.3 Waste Load Survey Data Analysis The table gives 52 weekly average flow and BOD5 data for wastewater Plot the data in variety of ways that might interest an engineer who needs to base a treatment ... the average peak value at each concentration level which has flattened the data by looking at deviations from the average of the three values at each level An important fact is revealed: the measurement ... Make simple plots by hand as the data become available If the plots are made at some future date to provide a record of what happened in the distant past, it will be too late to take appropriate...

Ngày tải lên: 20/01/2014, 01:20

10 402 1
Tài liệu Statistics for Environmental Engineers P1 ppt

Tài liệu Statistics for Environmental Engineers P1 ppt

... represents a sample A statistic is a realized quantity calculated from data that are taken to represent a population A parameter is an idealized quantity associated with the population Parameters cannot ... calculated from the sample Statistics are random variables and are characterized by a probability distribution that has a mean and a variance All measurements are subject to experimental (measurement) ... Sampling Distribution of the Average and the Variance All calculated statistics are random variables and, as such, are characterized by a probability distribution having an expected value (mean)...

Ngày tải lên: 20/01/2014, 01:20

40 453 1
Tài liệu Response statistics for ''''New Legislative Framework for the marketing of products: proposal to align 10 product harmonisation directives to Decision 768/2008.'''' pdf

Tài liệu Response statistics for ''''New Legislative Framework for the marketing of products: proposal to align 10 product harmonisation directives to Decision 768/2008.'''' pdf

... streamlined The new procedure ensures that the relevant enforcement authorities are informed about dangerous products and that equivalent action is taken against that product in all Member States ... Moderate increase in operating costs and/or adm burden Significant increase in operating costs and/or adm burden N /A C27 If you answered that Action may result in a significant increase in operating ... the obligations that the current legislation already foresees for manufacturers they must provide instructions and safety information in the language easily understood by consumers and end-users...

Ngày tải lên: 19/02/2014, 03:20

18 425 0
Báo cáo khoa học: "A Descriptive Framework for Translating Speaker''''s Meaning Towards a Dialogue Translation System between Japanese and English" pot

Báo cáo khoa học: "A Descriptive Framework for Translating Speaker''''s Meaning Towards a Dialogue Translation System between Japanese and English" pot

... multiple analyses are disambiguated (3-3), the surface analysis of (3-2), is analyzed as (4-5) This enables an adequate English translation (4-8) instead of an inappropriate literal translation ... that is a modification of the former for dealing with Japanese On the basis of a unification parser developed at ATR (Kogure et al 1988), the grammar has been written and proven capable of analyzing ... syntactically by m e a n s of predicateinternal collocation, adjunction, tense, and modal information An IFT-Schema consists of a goal whose value is a partial description of a deep IFT, and a...

Ngày tải lên: 09/03/2014, 01:20

8 329 0
Summary Health Statistics for U.S. Children: National Health Interview Survey, 2010 pdf

Summary Health Statistics for U.S. Children: National Health Interview Survey, 2010 pdf

... than last year Selected characteristic About the same as last year Good Worse than last year Better than last year About the same as last year Fair or poor Worse than last year Better than last ... Better than last year About the same as last year Fair or poor Worse than last year Better than last year About the same as last year Worse than last year Number in thousands2 Large MSA ... selected characteristics may not add to totals because of rounding Estimates for age groups are not age adjusted In accordance with the 1997 standards for federal data on race and Hispanic or Latino...

Ngày tải lên: 14/03/2014, 09:20

89 738 1
Statistics for Nursing and Allied Health pot

Statistics for Nursing and Allied Health pot

... provide a way of organizing data using a table format They allow readers to grasp the basic characteristics of the distribution of the variable quickly When the data are organized into a table format, ... possible categories, such as gender, are considered nominal variables These two-category variables are called “dichotomous” variables Ordinal Variables Ordinal scale variables can be placed in a meaningful ... every variable (see Chapter 2) and examining those frequencies carefully for valid values, unusual values, large amounts of missing data, and adequate variability For example, if the variable gender...

Ngày tải lên: 15/03/2014, 09:20

434 4,3K 0
Báo cáo khoa học: "Noun-phrase co-occurrence statistics for semi-automatic semantic lexicon construction" ppt

Báo cáo khoa học: "Noun-phrase co-occurrence statistics for semi-automatic semantic lexicon construction" ppt

... states (as in static states of affairs), and machines This last category was run because of the sparse d a t a for the category weapon in the Wall Street Journal It represents roughly the same ... Dragonfly plane(s), passenger plane(s), Cessna plane(s), twin-engined Cessna plane(s), C-47 plane(s), grayplane(s), KFIR plane(s), Avianca-HK1803 plane(s), LATN plane(s), Aeronica plane(s), 0-2 plane(s), ... iiii a noun phrase, between head nouns t h a t are separated by a c o m m a or conjunction If the sentence had read: "A cargo aircraft, fighter plane, or combat helicopter ", then aircraft, plane,...

Ngày tải lên: 23/03/2014, 19:20

7 161 0
A Foucauldian Approach to International Law Descriptive Thoughts for Normative Issues pot

A Foucauldian Approach to International Law Descriptive Thoughts for Normative Issues pot

... criteria that sway a state’s decision as an actor in the international system Thus, one also may account for external criteria that influence a state, such as human rights considerations that are taken ... organisations, especially internal and external accountability issues, the chapter will offer the means for engaging an approach to international relations and international law that incorporates various ... recognition as a political as well as legal tool in the international arena, how can one account for the use of state power when analyzing the matter from a transformative approach? Does power become a...

Ngày tải lên: 30/03/2014, 10:20

163 474 0
fundamentals of probability and statistics for engineers - t t soong

fundamentals of probability and statistics for engineers - t t soong

... verification and parameter estimation (E) on the basis of observed data (D) fall within the framework of statistical inference A model A: Probability and random variables B: Factual observations and ... ABC; b b b AB ˆ BA; b b Y A B ‘ C† ˆ …AB† ‘ …AC†: Clearly, we also have W A ‘ A ˆ AA ˆ A; b b b b A ‘ Y ˆ A; b b b b b AY ˆ Y; a A ‘ S ˆ S; b b AS ˆ A; b b b b b A ‘ A ˆ S; b b Y AA ˆ Y: …2:9† Moreover, ... events has the form P A1 A2 F F F An † ˆ P A1 †P A2 jA1 †P A3 jA1 A2 † F F F P…An jA1 A2 F F F AnÀ1 †: …2:26† where P (A i ) > for all i This can be verified by successive applications of Equation...

Ngày tải lên: 31/03/2014, 16:23

408 657 0
algebraic statistics for computational biology - lior pachter and bernd sturmfels

algebraic statistics for computational biology - lior pachter and bernd sturmfels

... ℓ(θ) Example 1.16 Our data are two DNA sequences of length 40: ATCACCAAACATTGGGATGCCTGTGCATTTGCAAGCGGCT ATGAGTCTTAAACGCTGGCCATGTGCCATCTTAGACAGCG (1.41) We wish to test the hypothesis that these ... computational biology or mathematical statistics: ours are written in the language of abstract algebra The algebraic language for statistics clarifies many of the ideas central to the analysis ... four-letter alphabet {A, C, G, T} An example of such a sequence is CTCACGTGATGAGAGCATTCTCAGACCGTGACGCGTGTAGCAGCGGCTC (1.1) The sequences produced by DiaNA are called DNA sequences DiaNA generates her sequences...

Ngày tải lên: 08/04/2014, 13:10

432 267 0
Introduction to Statistics for Biomedical Engineers doc

Introduction to Statistics for Biomedical Engineers doc

... collected and analyzed if the data analysis and subsequent conclusions are to have any value 3.2 WHY DO WE NEED STATISTICS? We have three major reasons for using statistical data summary and analysis: ... Sample Data Now that we have collected the data, graphed the histogram, estimated measures of central tendency and variability, such as mean, median, and standard deviation, we are ready to assume ... summarize data in graphical or numerical form The numerical form is what we refer to as statistics Before blindly applying the statistical analysis, it is always good to look at the raw data,...

Ngày tải lên: 27/06/2014, 10:20

103 297 0
Statistics for Economics, Accounting and Business Studies ppt

Statistics for Economics, Accounting and Business Studies ppt

... Important formulae used in this book 359 Appendix: Tables 364 364 366 367 368 370 372 374 376 378 379 Table A1 Table A2 Table A3 Table A4 Table A5 (a) Table A5 (b) Table A5 (c) Table A5 (d) Table A6 Table ... Library Cataloguing-in-Publication Data A catalogue record for this book is available from the British Library Library of Congress Cataloging-in-Publication Data Barrow, Michael Statistics for ... mean and the population mean The weighted average The median The mode Measures of dispersion The variance The standard deviation The variance and standard deviation of a sample Alternative formulae...

Ngày tải lên: 28/06/2014, 17:20

415 496 0
Probability and Statistics for Programmers.Think StatsProbability and Statistics for ppt

Probability and Statistics for Programmers.Think StatsProbability and Statistics for ppt

... generate statistics that summarize the data concisely, and evaluate different ways to visualize data Exploratory data analysis: We will look for patterns, differences, and other features that address ... is often freely available2 Another way to find data is Wolfram Alpha, which is a curated collection of good-quality datasets at http://wolframalpha.com Results from Wolfram Alpha are subject to ... is also used for animals, vegetables and minerals3 cross-sectional study: A study that collects data about a population at a particular point in time longitudinal study: A study that follows a...

Ngày tải lên: 28/06/2014, 20:20

142 436 0
Inequalities for random variables

Inequalities for random variables

... inequalities for univariate and multivariate real functions and their natural application to the error analysis of numerical quadrature for both simple and multiple integrals as well as for the ... density functions are continuous on [a, b] 2.2 Application for a Beta Random Variable Assume that X is a Beta random variable with parameters (p, q) as defined in (1.2) We observe that for < p < 1, ... − a ≥ Pr X ≥ ≥ b a F (t) dt a+ b b − sgn t − a a+b F (t) dt 1.2 Applications for a Beta Random Variable A Beta random variable X with parameters (p, q) has the probability density function xp−1...

Ngày tải lên: 20/07/2014, 18:38

291 159 0
Báo cáo toán học: " A Macdonald Vertex Operator and Standard Tableaux Statistics for the Two-Column (q, t)-Kostka Coefficients" doc

Báo cáo toán học: " A Macdonald Vertex Operator and Standard Tableaux Statistics for the Two-Column (q, t)-Kostka Coefficients" doc

... of the tableau decreases by when the labels are decreased A tableau that has a label of lying above the can be transposed about the diagonal and this tableau is isomorphic to a tableau of content ... ωT is the tableau that is flipped about the diagonal Each standard tableau has either the label of lying to the immediate right of or above it A tableau that has a that lies immediately to the ... previous section The ’atoms’ of the Macdonald polynomials and the µ − type of the standard tableaux suggest that the tableaux naturally fall into standard tableaux classes a For a sequence s ∈ , ×...

Ngày tải lên: 07/08/2014, 06:22

46 260 0
Báo cáo toán học: "Conjectured Statistics for the Higher q, t-Catalan Sequences" potx

Báo cáo toán học: "Conjectured Statistics for the Higher q, t-Catalan Sequences" potx

... particular, OCn (q, t) is a polynomial in q and t with nonnegative integer coefficients for all n This theorem was proved in various papers of Garsia, Haiman, and Haglund In [7], Garsia and Haiman ... t-Catalan sequences 1.1 The Original q, t-Catalan Sequence To give Garsia and Haiman’s original definition of the q, t-Catalan sequence, we first need to review some standard terminology associated ... 1)] (3) i

Ngày tải lên: 07/08/2014, 08:22

54 220 0
Báo cáo toán học: "Partition statistics for cubic partition pairs" pptx

Báo cáo toán học: "Partition statistics for cubic partition pairs" pptx

... corollary is also immediate Corollary For all n ≥ 0, b(7n + a) ≡ (mod 7), if a = 2, 3, 4, or combinatorial interpretation of M ∗(m, n) To give a combinatorial explanation of the famous Ramanujan partition ... Kim, A crank analog on a certain kind of partition function arising from the cubic continued fraction, Acta Arith 148 (2011), 1–19 [7] H Zhao and Z Zhong, Ramanujan type congreuences for a certain ... H.-C Chan, Ramanujan’s cubic continued fraction and an analog of his “most beautiful identity”, Int J Number Thy (2010), 673–680 [4] H.-C Chan, Ramanujan’s cubic continued fraction and Ramanujan...

Ngày tải lên: 08/08/2014, 14:23

7 89 0
w